Family mir-183


Download the aligments for this family. (.stk)

RNA Shape

Level1
(((()))) 
Level2
() 

Consensus Secondary Structure representation

>predicted reference mir-183 
AUUUACUCCUGUUCUGUGUAUGGCACUGGUAGAAUUCACUGUGAAAACUCACUGUCAGUGAAUUACCAAAGGGCCAUAAACAGAGCAGAGAAAUAUCCACAA
.............((((.((((((..(((((..((((((((..............)))))))))))))....)))))).))))...................





Contribute: Everyone is welcome to give feedback concerning the database.
If you have any advice or suggestions for corrections or improvements, please : rnarchitecture@genesilico.pl

Copyright © Genesilico - All rights reserved