SimRNAweb


SimRNA (1kh6 revised without restraints)

RNA models for: 260c8ff6-f24e-4eff-9760-1831407fc770/ (1kh6 revised without restraints)

GGCGGAACCGGUGAGUACACCGGAAUCCGAAAGGAUUUGGGCG UGCCCCCGCC
wdawson@genesilico.pl
n steps: 1000 (~ n of SimRNA frames: 80000, curr n of frames 80001 = 100.0%)

The representatives of top three clusters of your simulation:

The trafl file for the simulation can be found here (the file might be > 1GB!).

The raw output files for each step of the pipeline can be found here

#1 cluster (final prediction):

260c8ff6-f24e-4eff-9760-1831407fc770

#2 cluster:

#3 cluster:

The secondary structures of the representatives of top three clusters.

GGCGGAACCGGUGAGUACACCGGAAUCCGAAAGGAUUUGGGCG UGCCCCCGCC

> 260c8ff6-f24e-4eff-9760-1831407fc770_ALL_thrs5.30A_clust01-000001.ss_detected
(((((..((((((....))))))(((((....))).))((((. .)))))))))

> 260c8ff6-f24e-4eff-9760-1831407fc770_ALL_thrs5.30A_clust02-000001.ss_detected
(((((..((((((....))))))(((((....))))).((((( ))))))))))

> 260c8ff6-f24e-4eff-9760-1831407fc770_ALL_thrs5.30A_clust03-000001.ss_detected
(((((..((((((....))))))(((((....))).))((((( ))))))))))

The log of the data processing.

Processing log:
2016-01-24 06:14
WORKING_DIR /home/magnus/SimRNA_automation/WORKING_SPACE
number of run directories detected: 8
making directory: /home/magnus/SimRNA_automation/WORKING_SPACE/260c8ff6-f24e-4eff-9760-1831407fc770/processing_results
being in /home/magnus/SimRNA_automation/WORKING_SPACE/260c8ff6-f24e-4eff-9760-1831407fc770/processing_results  running command:
cat ../run_??/*.trafl > 260c8ff6-f24e-4eff-9760-1831407fc770_ALL.trafl
nframes: 80001
clustering ... assuming:
--- fraction of lowest energy frames to clustering: 0.01
--- rmsd thrs for clustering 0.1*seq_lenght which is: 5.3
../../../bin/clustering 260c8ff6-f24e-4eff-9760-1831407fc770_ALL.trafl 0.01 5.3 > clustering.log 2>&1
number of clusters to process: 3
extracting pdbs, reconstructing all atom representation
creating symlink 'data'
../../../bin/SimRNA_trafl2pdbs ../run_01/260c8ff6-f24e-4eff-9760-1831407fc770_run_01_01-000001.pdb 260c8ff6-f24e-4eff-9760-1831407fc770_ALL_thrs5.30A_clust01.trafl 1 AA > 260c8ff6-f24e-4eff-9760-1831407fc770_ALL_thrs5.30A_clust01.log 2>&1
../../../bin/SimRNA_trafl2pdbs ../run_01/260c8ff6-f24e-4eff-9760-1831407fc770_run_01_01-000001.pdb 260c8ff6-f24e-4eff-9760-1831407fc770_ALL_thrs5.30A_clust02.trafl 1 AA > 260c8ff6-f24e-4eff-9760-1831407fc770_ALL_thrs5.30A_clust02.log 2>&1
../../../bin/SimRNA_trafl2pdbs ../run_01/260c8ff6-f24e-4eff-9760-1831407fc770_run_01_01-000001.pdb 260c8ff6-f24e-4eff-9760-1831407fc770_ALL_thrs5.30A_clust03.trafl 1 AA > 260c8ff6-f24e-4eff-9760-1831407fc770_ALL_thrs5.30A_clust03.log 2>&1
directory already exists
detected pdb files in: processing_results:
curr_pdb_name 260c8ff6-f24e-4eff-9760-1831407fc770_ALL_thrs5.30A_clust01-000001.pdb
curr_pdb_name 260c8ff6-f24e-4eff-9760-1831407fc770_ALL_thrs5.30A_clust01-000001_AA.pdb
curr_pdb_name 260c8ff6-f24e-4eff-9760-1831407fc770_ALL_thrs5.30A_clust02-000001.pdb
curr_pdb_name 260c8ff6-f24e-4eff-9760-1831407fc770_ALL_thrs5.30A_clust02-000001_AA.pdb
curr_pdb_name 260c8ff6-f24e-4eff-9760-1831407fc770_ALL_thrs5.30A_clust03-000001.pdb
curr_pdb_name 260c8ff6-f24e-4eff-9760-1831407fc770_ALL_thrs5.30A_clust03-000001_AA.pdb
copying pdb and ss_detected files to: output_PDBS just to store them there
DONE :-)
Job log:
SimRNA_automatation
--------------------------------------------------------------------------------
2016-01-23 17:27
usage: run_SimRNA_prediction.py job_id_name file_sequence [file_second_strc] [pdb_file] [restraints_file] [nsteps] [debug true|false]
note: job_id_name should be legal string, to be used to set up working directory for this job
note: file_sequence and (optional) file_second_strc has to comply SimRNA requirements for those files
WORKING_DIR: /home/magnus/SimRNA_automation/WORKING_SPACE

in /home/magnus/SimRNA_automation/WORKING_SPACE making subdirectory: 260c8ff6-f24e-4eff-9760-1831407fc770


COPYING...
copying sequence file: /home/magnus/simrnaweb/media/jobs//260c8ff6-f24e-4eff-9760-1831407fc770/seq.fa to: /home/magnus/SimRNA_automation/WORKING_SPACE/260c8ff6-f24e-4eff-9760-1831407fc770, just to have it there (for further checking)
copying secondary structure file: /home/magnus/simrnaweb/media/jobs//260c8ff6-f24e-4eff-9760-1831407fc770/seq.ss to: /home/magnus/SimRNA_automation/WORKING_SPACE/260c8ff6-f24e-4eff-9760-1831407fc770, just to have it there (for further checking)
copying config.dat to 260c8ff6-f24e-4eff-9760-1831407fc770 to have it there, because parent one can be changed
in /home/magnus/SimRNA_automation/WORKING_SPACE/260c8ff6-f24e-4eff-9760-1831407fc770 making directories:
run_01
creating symlink 'data'
making SimRNA run file: r_260c8ff6-f24e-4eff-9760-1831407fc770_run_01
SimRNA::test -n 1 if setup is correct
cmd test:
../../../bin/SimRNA -c ../config.dat -R 1 -o 260c8ff6-f24e-4eff-9760-1831407fc770_run_01 -E 10  -S ../seq.ss  -s ../seq.fa  -n 1 -E 1 
SimRNA (c) 2009-2014 Genesilico, ver. 3.20

 program compiled as SimRNA3: 3 atoms per base

.reading parameteres
class RNAStructure: SimRNA3 flag is set
chain 1 read from: ../seq.fa: GGCGGAACCGGUGAGUACACCGGAAUCCGAAAGGAUUUGGGCG
chain 2 read from: ../seq.fa: UGCCCCCGCC
chains:
chain A contains 43 nucleotides
chain B contains 10 nucleotides
loading histrogram: ./data/dist_PC.data.new_hist   assigned_name: dist_PC.data.new_hist  DONE
loading histrogram: ./data/dist_CP.data.new_hist   assigned_name: dist_CP.data.new_hist  DONE
loading histrogram: ./data/angle_PCP.data.new_hist   assigned_name: angle_PCP.data.new_hist  DONE
loading histrogram: ./data/angle_CPC.data.new_hist   assigned_name: angle_CPC.data.new_hist  DONE
loading histrogram: ./data/eta_theta.data.new_hist   assigned_name: eta_theta.data.new_hist  DONE
reading conformers file: ./data/A_conformers
n_lines: 4766
   16    15    69    34    27 
   46    26   156    83    35 
   93   127  1269    89    50 
  187   157  1927    88    75 
   51    22    67    25    32 
DONE
reading conformers file: ./data/C_conformers
n_lines: 5164
    7     8    61    17     4 
   14    12   143    49    12 
   23   140  2110    21    24 
   88   101  2101    19    36 
   25    21   108     8    12 
DONE
reading conformers file: ./data/G_conformers
n_lines: 6375
   11     7    79    21    50 
   20    17   175    54    39 
   42   102  2774    90    34 
   61    94  2314    71   100 
   20    22   142    15    21 
DONE
reading conformers file: ./data/U_conformers
n_lines: 3617
    6     6    43    33    24 
   20    20   131    50    28 
   30    58  1412    30    24 
   64    82  1197    31    32 
   71    36   132    13    44 
DONE
loading histrogram: ./data/AA3.hist   assigned_name: AA3.hist  DONE
loading histrogram: ./data/AC3.hist   assigned_name: AC3.hist  DONE
loading histrogram: ./data/AG3.hist   assigned_name: AG3.hist  DONE
loading histrogram: ./data/AU3.hist   assigned_name: AU3.hist  DONE
loading histrogram: ./data/CA3.hist   assigned_name: CA3.hist  DONE
loading histrogram: ./data/CC3.hist   assigned_name: CC3.hist  DONE
loading histrogram: ./data/CG3.hist   assigned_name: CG3.hist  DONE
loading histrogram: ./data/CU3.hist   assigned_name: CU3.hist  DONE
loading histrogram: ./data/GA3.hist   assigned_name: GA3.hist  DONE
loading histrogram: ./data/GC3.hist   assigned_name: GC3.hist  DONE
loading histrogram: ./data/GG3.hist   assigned_name: GG3.hist  DONE
loading histrogram: ./data/GU3.hist   assigned_name: GU3.hist  DONE
loading histrogram: ./data/UA3.hist   assigned_name: UA3.hist  DONE
loading histrogram: ./data/UC3.hist   assigned_name: UC3.hist  DONE
loading histrogram: ./data/UG3.hist   assigned_name: UG3.hist  DONE
loading histrogram: ./data/UU3.hist   assigned_name: UU3.hist  DONE
loading histrogram: ./data/A-C4_3.hist   assigned_name: A-C4_3.hist  DONE
loading histrogram: ./data/C-C4_3.hist   assigned_name: C-C4_3.hist  DONE
loading histrogram: ./data/G-C4_3.hist   assigned_name: G-C4_3.hist  DONE
loading histrogram: ./data/U-C4_3.hist   assigned_name: U-C4_3.hist  DONE
loading histrogram: ./data/A-P_3.hist   assigned_name: A-P_3.hist  DONE
loading histrogram: ./data/C-P_3.hist   assigned_name: C-P_3.hist  DONE
loading histrogram: ./data/G-P_3.hist   assigned_name: G-P_3.hist  DONE
loading histrogram: ./data/U-P_3.hist   assigned_name: U-P_3.hist  DONE
loading histrogram: ./data/A_3_exvol.hist   assigned_name: A_3_exvol.hist  DONE
scaling: histogram A_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/C_3_exvol.hist   assigned_name: C_3_exvol.hist  DONE
scaling: histogram C_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/G_3_exvol.hist   assigned_name: G_3_exvol.hist  DONE
scaling: histogram G_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/U_3_exvol.hist   assigned_name: U_3_exvol.hist  DONE
scaling: histogram U_3_exvol.hist was multiplied by 0.100000
scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000
eta-theta term was reweighted by factor 0.400000 provided by the user
begin: void RNAStructureWithRestraints::initSecondStrcRestraints(const char* path)
RNAStructureWithRestraints::secondStrcWeight = 1.000000
 end: void RNAStructureWithRestraints::initSecondStrcRestraints(const char* path)

calculated limiting sphere radius:  53.000 [A]

random seed = 1
number of iterations = 1
trajectory write in every 16000 iterations
initTemp  = 1.350
finalTemp = 0.900
tempStep = -4.500000e-01
DONE

.calculating
==================================
Write number: 1

Temperature: 1.350000

Total energy of system -171.389621
where:
	Base-Base interactions energy   -8.147
	where:  short stacking energy   -8.147 

	Base-Backbone interact. energy   -0.000

	Local geometry energy -208.683747
	where:
		bonds (distance)  C4'-P  energy:  -51.494
		bonds (distance)  P-C4'  energy:  -47.417
		flat angles   C4'-P-C4'  energy:  -37.445
		flat angles    P-C4'-P   energy:  -44.513
		tors. eta vs tors. theta energy:  -27.815

	limit. sphere exceed penalty:   45.441
	dist. restrs. and SS energy:    0.000


.writing output

current chain energy: -168.499062
recalc. chain energy: -168.499062
numberOfNucleotides: 53
initial temperature kT: 1.350000
moves confirmed at first:  8
moves confirmed later: 7
all moves confirmed: 15
percent of confirmed moves: 15.000000

 Time of doing 1 iterations:  0.002 seconds
It seems that the setup is correct
Cmd:
../../../bin/SimRNA -c ../config.dat -R 1 -o 260c8ff6-f24e-4eff-9760-1831407fc770_run_01 -E 10  -S ../seq.ss  -s ../seq.fa  -n 16000000  >& r_260c8ff6-f24e-4eff-9760-1831407fc770_run_01.out
run_02
creating symlink 'data'
making SimRNA run file: r_260c8ff6-f24e-4eff-9760-1831407fc770_run_02
Cmd:
../../../bin/SimRNA -c ../config.dat -R 2 -o 260c8ff6-f24e-4eff-9760-1831407fc770_run_02 -E 10  -S ../seq.ss  -s ../seq.fa  -n 16000000  >& r_260c8ff6-f24e-4eff-9760-1831407fc770_run_02.out
run_03
creating symlink 'data'
making SimRNA run file: r_260c8ff6-f24e-4eff-9760-1831407fc770_run_03
Cmd:
../../../bin/SimRNA -c ../config.dat -R 3 -o 260c8ff6-f24e-4eff-9760-1831407fc770_run_03 -E 10  -S ../seq.ss  -s ../seq.fa  -n 16000000  >& r_260c8ff6-f24e-4eff-9760-1831407fc770_run_03.out
run_04
creating symlink 'data'
making SimRNA run file: r_260c8ff6-f24e-4eff-9760-1831407fc770_run_04
Cmd:
../../../bin/SimRNA -c ../config.dat -R 4 -o 260c8ff6-f24e-4eff-9760-1831407fc770_run_04 -E 10  -S ../seq.ss  -s ../seq.fa  -n 16000000  >& r_260c8ff6-f24e-4eff-9760-1831407fc770_run_04.out
run_05
creating symlink 'data'
making SimRNA run file: r_260c8ff6-f24e-4qsub: /usr/bin/qsub /usr/share/man/man1/qsub.1B.gz
qsub: /usr/bin/qsub /usr/share/man/man1/qsub.1B.gz
qsub: /usr/bin/qsub /usr/share/man/man1/qsub.1B.gz
qsub: /usr/bin/qsub /usr/share/man/man1/qsub.1B.gz
qsub: /usr/bin/qsub /usr/share/man/man1/qsub.1B.gz
qsub: /usr/bin/qsub /usr/share/man/man1/qsub.1B.gz
qsub: /usr/bin/qsub /usr/share/man/man1/qsub.1B.gz
qsub: /usr/bin/qsub /usr/share/man/man1/qsub.1B.gz
eff-9760-1831407fc770_run_05
Cmd:
../../../bin/SimRNA -c ../config.dat -R 5 -o 260c8ff6-f24e-4eff-9760-1831407fc770_run_05 -E 10  -S ../seq.ss  -s ../seq.fa  -n 16000000  >& r_260c8ff6-f24e-4eff-9760-1831407fc770_run_05.out
run_06
creating symlink 'data'
making SimRNA run file: r_260c8ff6-f24e-4eff-9760-1831407fc770_run_06
Cmd:
../../../bin/SimRNA -c ../config.dat -R 6 -o 260c8ff6-f24e-4eff-9760-1831407fc770_run_06 -E 10  -S ../seq.ss  -s ../seq.fa  -n 16000000  >& r_260c8ff6-f24e-4eff-9760-1831407fc770_run_06.out
run_07
creating symlink 'data'
making SimRNA run file: r_260c8ff6-f24e-4eff-9760-1831407fc770_run_07
Cmd:
../../../bin/SimRNA -c ../config.dat -R 7 -o 260c8ff6-f24e-4eff-9760-1831407fc770_run_07 -E 10  -S ../seq.ss  -s ../seq.fa  -n 16000000  >& r_260c8ff6-f24e-4eff-9760-1831407fc770_run_07.out
run_08
creating symlink 'data'
making SimRNA run file: r_260c8ff6-f24e-4eff-9760-1831407fc770_run_08
Cmd:
../../../bin/SimRNA -c ../config.dat -R 8 -o 260c8ff6-f24e-4eff-9760-1831407fc770_run_08 -E 10  -S ../seq.ss  -s ../seq.fa  -n 16000000  >& r_260c8ff6-f24e-4eff-9760-1831407fc770_run_08.out
--------------------------------------------------------------------------------
SUBMITTING JOBS:
curr path /home/magnus/SimRNA_automation/WORKING_SPACE/260c8ff6-f24e-4eff-9760-1831407fc770/run_01
cmd @ cluster /home/oge/bin/lx24-amd64/qsub -cwd -l h_vmem=300M -l mem_free=500M -pe mpi 10 r_260c8ff6-f24e-4eff-9760-1831407fc770_run_01
Your job 4404581 ("r_260c8ff6-f24e-4eff-9760-1831407fc770_run_01") has been submitted
curr path /home/magnus/SimRNA_automation/WORKING_SPACE/260c8ff6-f24e-4eff-9760-1831407fc770/run_02
cmd @ cluster /home/oge/bin/lx24-amd64/qsub -cwd -l h_vmem=300M -l mem_free=500M -pe mpi 10 r_260c8ff6-f24e-4eff-9760-1831407fc770_run_02
Your job 4404582 ("r_260c8ff6-f24e-4eff-9760-1831407fc770_run_02") has been submitted
curr path /home/magnus/SimRNA_automation/WORKING_SPACE/260c8ff6-f24e-4eff-9760-1831407fc770/run_03
cmd @ cluster /home/oge/bin/lx24-amd64/qsub -cwd -l h_vmem=300M -l mem_free=500M -pe mpi 10 r_260c8ff6-f24e-4eff-9760-1831407fc770_run_03
Your job 4404583 ("r_260c8ff6-f24e-4eff-9760-1831407fc770_run_03") has been submitted
curr path /home/magnus/SimRNA_automation/WORKING_SPACE/260c8ff6-f24e-4eff-9760-1831407fc770/run_04
cmd @ cluster /home/oge/bin/lx24-amd64/qsub -cwd -l h_vmem=300M -l mem_free=500M -pe mpi 10 r_260c8ff6-f24e-4eff-9760-1831407fc770_run_04
Your job 4404584 ("r_260c8ff6-f24e-4eff-9760-1831407fc770_run_04") has been submitted
curr path /home/magnus/SimRNA_automation/WORKING_SPACE/260c8ff6-f24e-4eff-9760-1831407fc770/run_05
cmd @ cluster /home/oge/bin/lx24-amd64/qsub -cwd -l h_vmem=300M -l mem_free=500M -pe mpi 10 r_260c8ff6-f24e-4eff-9760-1831407fc770_run_05
Your job 4404585 ("r_260c8ff6-f24e-4eff-9760-1831407fc770_run_05") has been submitted
curr path /home/magnus/SimRNA_automation/WORKING_SPACE/260c8ff6-f24e-4eff-9760-1831407fc770/run_06
cmd @ cluster /home/oge/bin/lx24-amd64/qsub -cwd -l h_vmem=300M -l mem_free=500M -pe mpi 10 r_260c8ff6-f24e-4eff-9760-1831407fc770_run_06
Your job 4404586 ("r_260c8ff6-f24e-4eff-9760-1831407fc770_run_06") has been submitted
curr path /home/magnus/SimRNA_automation/WORKING_SPACE/260c8ff6-f24e-4eff-9760-1831407fc770/run_07
cmd @ cluster /home/oge/bin/lx24-amd64/qsub -cwd -l h_vmem=300M -l mem_free=500M -pe mpi 10 r_260c8ff6-f24e-4eff-9760-1831407fc770_run_07
Your job 4404587 ("r_260c8ff6-f24e-4eff-9760-1831407fc770_run_07") has been submitted
curr path /home/magnus/SimRNA_automation/WORKING_SPACE/260c8ff6-f24e-4eff-9760-1831407fc770/run_08
cmd @ cluster /home/oge/bin/lx24-amd64/qsub -cwd -l h_vmem=300M -l mem_free=500M -pe mpi 10 r_260c8ff6-f24e-4eff-9760-1831407fc770_run_08
Your job 4404588 ("r_260c8ff6-f24e-4eff-9760-1831407fc770_run_08") has been submitted
run_SimRNA_prediction .. [OK]