SimRNAweb


SimRNA (3l0u ss + rst)

RNA models for: f3c68edc-99c2-4950-9efd-0486812f15ae (3l0u ss + rst)

GCGCGGAUAGCUCAGUCGGUAGAGCAGGGGAUUGAAAAUCCCCGUGUCCUUGGUUCGAUUCCGAGUCCGCGCA
(((((((..((((........)))).((((((.....)))))).....(((((.......)))))))))))).
wdawson@genesilico.pl
SLOPE A/8/P    A/13/P   9.1  10.1  0.2
SLOPE A/8/P    A/14/P   9.6  10.6  0.2
SLOPE A/8/N1   A/13/N1  6.3   6.9  0.6
SLOPE A/8/N1   A/14/N9  6.8   7.4  0.6
SLOPE A/48/P   A/50/P   5.0   5.6  0.6
SLOPE A/8/P    A/49/P   6.0   7.0  0.2
n steps: 300 (~ n of SimRNA frames: 24000, curr n of frames 24051 = 100.21%)

The representatives of top three clusters of your simulation:

The trafl file for the simulation can be found here (the file might be > 1GB!).

The raw output files for each step of the pipeline can be found here

#1 cluster (final prediction):

f3c68edc-99c2-4950-9efd-0486812f15ae

#2 cluster:

#3 cluster:

The secondary structures of the representatives of top three clusters.

GCGCGGAUAGCUCAGUCGGUAGAGCAGGGGAUUGAAAAUCCCCGUGUCCUUGGUUCGAUUCCGAGUCCGCGCA

> f3c68edc-99c2-4950-9efd-0486812f15ae_ALL_thrs7.30A_clust01-000001.ss_detected
(((((((..((((........)))).(((((((...))))))).....(((((.......)))))))))))).
...............(((.....................................)))...............

> f3c68edc-99c2-4950-9efd-0486812f15ae_ALL_thrs7.30A_clust02-000001.ss_detected
((((((...(((((.....).))))((((((((...))))))).)...(((((.......))))).)))))).
...............(((.....................................)))...............

> f3c68edc-99c2-4950-9efd-0486812f15ae_ALL_thrs7.30A_clust03-000001.ss_detected
(((((((..((((........))))((((((((...))))))).)...(((((.......)))))))))))).
..............((((.....................................))))..............

The log of the data processing.

Processing log:
2016-02-02 05:05
WORKING_DIR /home/magnus/SimRNA_automation/WORKING_SPACE
FRACTION_LOWEST_ENERGY_FRAMES_TO_CLUSTER: 0.01
number of run directories detected: 8
making directory: /home/magnus/SimRNA_automation/WORKING_SPACE/f3c68edc-99c2-4950-9efd-0486812f15ae/processing_results
requested subdirectory: processing_results already exists .. removing the directory!!!!!
being in /home/magnus/SimRNA_automation/WORKING_SPACE/f3c68edc-99c2-4950-9efd-0486812f15ae/processing_results  running command:
cat ../run_??/*.trafl > f3c68edc-99c2-4950-9efd-0486812f15ae_ALL.trafl
nframes: 24051
clustering ... assuming:
--- fraction of lowest energy frames to clustering: 0.01
--- rmsd thrs for clustering 0.1*seq_lenght which is: 7.3
../../../bin/clustering f3c68edc-99c2-4950-9efd-0486812f15ae_ALL.trafl 0.01 7.3 > clustering.log 2>&1
number of clusters to process: 3
extracting pdbs, reconstructing all atom representation
creating symlink 'data'
../../../bin/SimRNA_trafl2pdbs ../run_01/f3c68edc-99c2-4950-9efd-0486812f15ae_run_01_01-000001.pdb f3c68edc-99c2-4950-9efd-0486812f15ae_ALL_thrs7.30A_clust01.trafl 1 AA > f3c68edc-99c2-4950-9efd-0486812f15ae_ALL_thrs7.30A_clust01.log 2>&1
../../../bin/SimRNA_trafl2pdbs ../run_01/f3c68edc-99c2-4950-9efd-0486812f15ae_run_01_01-000001.pdb f3c68edc-99c2-4950-9efd-0486812f15ae_ALL_thrs7.30A_clust02.trafl 1 AA > f3c68edc-99c2-4950-9efd-0486812f15ae_ALL_thrs7.30A_clust02.log 2>&1
../../../bin/SimRNA_trafl2pdbs ../run_01/f3c68edc-99c2-4950-9efd-0486812f15ae_run_01_01-000001.pdb f3c68edc-99c2-4950-9efd-0486812f15ae_ALL_thrs7.30A_clust03.trafl 1 AA > f3c68edc-99c2-4950-9efd-0486812f15ae_ALL_thrs7.30A_clust03.log 2>&1
making directory: output_PDBS
directory already exists
detected pdb files in: processing_results:
curr_pdb_name f3c68edc-99c2-4950-9efd-0486812f15ae_ALL_thrs7.30A_clust01-000001.pdb
curr_pdb_name f3c68edc-99c2-4950-9efd-0486812f15ae_ALL_thrs7.30A_clust01-000001_AA.pdb
curr_pdb_name f3c68edc-99c2-4950-9efd-0486812f15ae_ALL_thrs7.30A_clust02-000001.pdb
curr_pdb_name f3c68edc-99c2-4950-9efd-0486812f15ae_ALL_thrs7.30A_clust02-000001_AA.pdb
curr_pdb_name f3c68edc-99c2-4950-9efd-0486812f15ae_ALL_thrs7.30A_clust03-000001.pdb
curr_pdb_name f3c68edc-99c2-4950-9efd-0486812f15ae_ALL_thrs7.30A_clust03-000001_AA.pdb
copying pdb and ss_detected files to: output_PDBS just to store them there
DONE :-)
Job log:
SimRNA_automatation
--------------------------------------------------------------------------------
2016-02-01 23:09
usage: run_SimRNA_prediction.py job_id_name file_sequence [file_second_strc] [pdb_file] [restraints_file] [nsteps] [debug true|false]
note: job_id_name should be legal string, to be used to set up working directory for this job
note: file_sequence and (optional) file_second_strc has to comply SimRNA requirements for those files
WORKING_DIR: /home/magnus/SimRNA_automation/WORKING_SPACE

in /home/magnus/SimRNA_automation/WORKING_SPACE making subdirectory: f3c68edc-99c2-4950-9efd-0486812f15ae


COPYING...
copying sequence file: /home/magnus/simrnaweb/media/jobs//f3c68edc-99c2-4950-9efd-0486812f15ae/seq.fa to: /home/magnus/SimRNA_automation/WORKING_SPACE/f3c68edc-99c2-4950-9efd-0486812f15ae, just to have it there (for further checking)
copying secondary structure file: /home/magnus/simrnaweb/media/jobs//f3c68edc-99c2-4950-9efd-0486812f15ae/seq.ss to: /home/magnus/SimRNA_automation/WORKING_SPACE/f3c68edc-99c2-4950-9efd-0486812f15ae, just to have it there (for further checking)
copying restraints file file: /home/magnus/simrnaweb/media/jobs//f3c68edc-99c2-4950-9efd-0486812f15ae/3l0ussw06rst3_a.rest to: /home/magnus/SimRNA_automation/WORKING_SPACE/f3c68edc-99c2-4950-9efd-0486812f15ae, just to have it there (for further checking)
copying config.dat to f3c68edc-99c2-4950-9efd-0486812f15ae to have it there, because parent one can be changed
in /home/magnus/SimRNA_automation/WORKING_SPACE/f3c68edc-99c2-4950-9efd-0486812f15ae making directories:
run_01
creating symlink 'data'
making SimRNA run file: r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_01
SimRNA::test -n 1 if setup is correct
cmd test:
../../../bin/SimRNA -c ../config.dat -R 1 -o f3c68edc-99c2-4950-9efd-0486812f15ae_run_01 -E 10  -S ../seq.ss  -s ../seq.fa  -r ../3l0ussw06rst3_a.rest  -n 1 -E 1 
SimRNA (c) 2009-2014 Genesilico, ver. 3.20

 program compiled as SimRNA3: 3 atoms per base

.reading parameteres
class RNAStructure: SimRNA3 flag is set
chain 1 read from: ../seq.fa: GCGCGGAUAGCUCAGUCGGUAGAGCAGGGGAUUGAAAAUCCCCGUGUCCUUGGUUCGAUUCCGAGUCCGCGCA
chains:
chain A contains 73 nucleotides
loading histrogram: ./data/dist_PC.data.new_hist   assigned_name: dist_PC.data.new_hist  DONE
loading histrogram: ./data/dist_CP.data.new_hist   assigned_name: dist_CP.data.new_hist  DONE
loading histrogram: ./data/angle_PCP.data.new_hist   assigned_name: angle_PCP.data.new_hist  DONE
loading histrogram: ./data/angle_CPC.data.new_hist   assigned_name: angle_CPC.data.new_hist  DONE
loading histrogram: ./data/eta_theta.data.new_hist   assigned_name: eta_theta.data.new_hist  DONE
reading conformers file: ./data/A_conformers
n_lines: 4766
   16    15    69    34    27 
   46    26   156    83    35 
   93   127  1269    89    50 
  187   157  1927    88    75 
   51    22    67    25    32 
DONE
reading conformers file: ./data/C_conformers
n_lines: 5164
    7     8    61    17     4 
   14    12   143    49    12 
   23   140  2110    21    24 
   88   101  2101    19    36 
   25    21   108     8    12 
DONE
reading conformers file: ./data/G_conformers
n_lines: 6375
   11     7    79    21    50 
   20    17   175    54    39 
   42   102  2774    90    34 
   61    94  2314    71   100 
   20    22   142    15    21 
DONE
reading conformers file: ./data/U_conformers
n_lines: 3617
    6     6    43    33    24 
   20    20   131    50    28 
   30    58  1412    30    24 
   64    82  1197    31    32 
   71    36   132    13    44 
DONE
loading histrogram: ./data/AA3.hist   assigned_name: AA3.hist  DONE
loading histrogram: ./data/AC3.hist   assigned_name: AC3.hist  DONE
loading histrogram: ./data/AG3.hist   assigned_name: AG3.hist  DONE
loading histrogram: ./data/AU3.hist   assigned_name: AU3.hist  DONE
loading histrogram: ./data/CA3.hist   assigned_name: CA3.hist  DONE
loading histrogram: ./data/CC3.hist   assigned_name: CC3.hist  DONE
loading histrogram: ./data/CG3.hist   assigned_name: CG3.hist  DONE
loading histrogram: ./data/CU3.hist   assigned_name: CU3.hist  DONE
loading histrogram: ./data/GA3.hist   assigned_name: GA3.hist  DONE
loading histrogram: ./data/GC3.hist   assigned_name: GC3.hist  DONE
loading histrogram: ./data/GG3.hist   assigned_name: GG3.hist  DONE
loading histrogram: ./data/GU3.hist   assigned_name: GU3.hist  DONE
loading histrogram: ./data/UA3.hist   assigned_name: UA3.hist  DONE
loading histrogram: ./data/UC3.hist   assigned_name: UC3.hist  DONE
loading histrogram: ./data/UG3.hist   assigned_name: UG3.hist  DONE
loading histrogram: ./data/UU3.hist   assigned_name: UU3.hist  DONE
loading histrogram: ./data/A-C4_3.hist   assigned_name: A-C4_3.hist  DONE
loading histrogram: ./data/C-C4_3.hist   assigned_name: C-C4_3.hist  DONE
loading histrogram: ./data/G-C4_3.hist   assigned_name: G-C4_3.hist  DONE
loading histrogram: ./data/U-C4_3.hist   assigned_name: U-C4_3.hist  DONE
loading histrogram: ./data/A-P_3.hist   assigned_name: A-P_3.hist  DONE
loading histrogram: ./data/C-P_3.hist   assigned_name: C-P_3.hist  DONE
loading histrogram: ./data/G-P_3.hist   assigned_name: G-P_3.hist  DONE
loading histrogram: ./data/U-P_3.hist   assigned_name: U-P_3.hist  DONE
loading histrogram: ./data/A_3_exvol.hist   assigned_name: A_3_exvol.hist  DONE
scaling: histogram A_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/C_3_exvol.hist   assigned_name: C_3_exvol.hist  DONE
scaling: histogram C_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/G_3_exvol.hist   assigned_name: G_3_exvol.hist  DONE
scaling: histogram G_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/U_3_exvol.hist   assigned_name: U_3_exvol.hist  DONE
scaling: histogram U_3_exvol.hist was multiplied by 0.100000
scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000
eta-theta term was reweighted by factor 0.400000 provided by the user
reading distance restraints...
distance restraint added:
chain A atom P nucl 8 and chain A atom P nucl 13, unrestricted dist. range: 9.100 10.100, weight 0.200
distance restraint added:
chain A atom P nucl 8 and chain A atom P nucl 14, unrestricted dist. range: 9.600 10.600, weight 0.200
distance restraint added:
chain A atom N1 nucl 8 and chain A atom N1 nucl 13, unrestricted dist. range: 6.300 6.900, weight 0.600
distance restraint added:
chain A atom N1 nucl 8 and chain A atom N9 nucl 14, unrestricted dist. range: 6.800 7.400, weight 0.600
distance restraint added:
chain A atom P nucl 48 and chain A atom P nucl 50, unrestricted dist. range: 5.000 5.600, weight 0.600
distance restraint added:
chain A atom P nucl 8 and chain A atom P nucl 49, unrestricted dist. range: 6.000 7.000, weight 0.200
DONE

begin: void RNAStructureWithRestraints::initSecondStrcRestraints(const char* path)
RNAStructureWithRestraints::secondStrcWeight = 1.000000
chain: 1: _(((((((..((((........)))).((((((.....)))))).....(((((.......))))))))))))._
nucl1: 12, chain1: 0, <--->  nucl2: 21, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 21
nucl1: 11, chain1: 0, <--->  nucl2: 22, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 22
nucl1: 10, chain1: 0, <--->  nucl2: 23, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 23
nucl1: 9, chain1: 0, <--->  nucl2: 24, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 24
nucl1: 31, chain1: 0, <--->  nucl2: 37, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 31, chainIndex_2: 0, nuclIndex_2: 37
nucl1: 30, chain1: 0, <--->  nucl2: 38, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 30, chainIndex_2: 0, nuclIndex_2: 38
nucl1: 29, chain1: 0, <--->  nucl2: 39, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 29, chainIndex_2: 0, nuclIndex_2: 39
nucl1: 28, chain1: 0, <--->  nucl2: 40, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 40
nucl1: 27, chain1: 0, <--->  nucl2: 41, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 41
nucl1: 26, chain1: 0, <--->  nucl2: 42, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 42
nucl1: 52, chain1: 0, <--->  nucl2: 60, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 60
nucl1: 51, chain1: 0, <--->  nucl2: 61, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 61
nucl1: 50, chain1: 0, <--->  nucl2: 62, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 50, chainIndex_2: 0, nuclIndex_2: 62
nucl1: 49, chain1: 0, <--->  nucl2: 63, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 49, chainIndex_2: 0, nuclIndex_2: 63
nucl1: 48, chain1: 0, <--->  nucl2: 64, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 48, chainIndex_2: 0, nuclIndex_2: 64
nucl1: 6, chain1: 0, <--->  nucl2: 65, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 65
nucl1: 5, chain1: 0, <--->  nucl2: 66, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 66
nucl1: 4, chain1: 0, <--->  nucl2: 67, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 67
nucl1: 3, chain1: 0, <--->  nucl2: 68, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 68
nucl1: 2, chain1: 0, <--->  nucl2: 69, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 69
nucl1: 1, chain1: 0, <--->  nucl2: 70, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 70
nucl1: 0, chain1: 0, <--->  nucl2: 71, chain2: 0
secondary structure restraint added:
chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2: 71
 end: void RNAStructureWithRestraints::initSecondStrcRestraints(const char* path)
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:   1
second atom: chain: A, nucl:  72
current score: 7.604
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:   2
second atom: chain: A, nucl:  71
current score: 16.365
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:   3
second atom: chain: A, nucl:  70
current score: 27.471
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:   4
second atom: chain: A, nucl:  69
current score: 35.299
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:   5
second atom: chain: A, nucl:  68
current score: 44.989
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:   6
second atom: chain: A, nucl:  67
current score: 53.678
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:   7
second atom: chain: A, nucl:  66
current score: 61.305
--------------------------------------
---------DistanceRestraint, restrsMode: SLOPE --------
first  atom: chain: A, nucl: 8 atom:  P  
second atom: chain: A, nucl: 13 atom:  P  
desired distance should be from 9.100 to 10.100, weight: 0.200
current distance is: 28.635, current score: 3.707
----------------------------
---------DistanceRestraint, restrsMode: SLOPE --------
first  atom: chain: A, nucl: 8 atom:  P  
second atom: chain: A, nucl: 14 atom:  P  
desired distance should be from 9.600 to 10.600, weight: 0.200
current distance is: 34.248, current score: 4.730
----------------------------
---------DistanceRestraint, restrsMode: SLOPE --------
first  atom: chain: A, nucl: 8 atom:  N1 
second atom: chain: A, nucl: 13 atom:  N1 
desired distance should be from 6.300 to 6.900, weight: 0.600
current distance is: 30.163, current score: 13.958
----------------------------
---------DistanceRestraint, restrsMode: SLOPE --------
first  atom: chain: A, nucl: 8 atom:  N1 
second atom: chain: A, nucl: 14 atom:  N9 
desired distance should be from 6.800 to 7.400, weight: 0.600
current distance is: 35.617, current score: 16.930
----------------------------
---------DistanceRestraint, restrsMode: SLOPE --------
first  atom: chain: A, nucl: 8 atom:  P  
second atom: chain: A, nucl: 49 atom:  P  
desired distance should be from 6.000 to 7.000, weight: 0.200
current distance is: 133.963, current score: 25.393
----------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  10
second atom: chain: A, nucl:  25
current score: 60.836
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  11
second atom: chain: A, nucl:  24
current score: 52.599
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  12
second atom: chain: A, nucl:  23
current score: 44.466
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  13
second atom: chain: A, nucl:  22
current score: 35.814
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  27
second atom: chain: A, nucl:  43
current score: 64.937
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  28
second atom: chain: A, nucl:  42
current score: 56.467
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  29
second atom: chain: A, nucl:  41
current score: 48.524
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  30
second atom: chain: A, nucl:  40
current score: 39.859
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  31
second atom: chain: A, nucl:  39
current score: 31.019
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  32
second atom: chain: A, nucl:  38
current score: 22.645
--------------------------------------
---------DistanceRestraint, restrsMode: SLOPE --------
first  atom: chain: A, nucl: 48 atom:  P  
second atom: chain: A, nucl: 50 atom:  P  
desired distance should be from 5.000 to 5.600, weight: 0.600
current distance is: 11.527, current score: 3.556
----------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  49
second atom: chain: A, nucl:  65
current score: 65.293
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  50
second atom: chain: A, nucl:  64
current score: 55.891
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  51
second atom: chain: A, nucl:  63
current score: 48.884
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  52
second atom: chain: A, nucl:  62
current score: 40.414
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  53
second atom: chain: A, nucl:  61
current score: 31.030
--------------------------------------

random seed = 1
number of iterations = 1
trajectory write in every 16000 iterations
initTemp  = 1.350
finalTemp = 0.900
tempStep = -4.500000e-01
DONE

.calculating
==================================
Write number: 1

Temperature: 1.350000

Total energy of system 712.276339
where:
	Base-Base interactions energy  -11.707
	where:  short stacking energy  -11.707 

	Base-Backbone interact. energy   -0.000

	Local geometry energy -289.677686
	where:
		bonds (distance)  C4'-P  energy:  -70.925
		bonds (distance)  P-C4'  energy:  -65.310
		flat angles   C4'-P-C4'  energy:  -52.864
		flat angles    P-C4'-P   energy:  -61.311
		tors. eta vs tors. theta energy:  -39.268
	dist. restrs. and SS energy: 1013.661


.writing output

current chain energy: 741.236943
recalc. chain energy: 741.236943
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:   1
second atom: chain: A, nucl:  72
current score: 7.750
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:   2
second atom: chain: A, nucl:  71
current score: 16.877
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:   3
second atom: chain: A, nucl:  70
current score: 26.823
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:   4
second atom: chain: A, nucl:  69
current score: 34.855
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:   5
second atom: chain: A, nucl:  68
current score: 44.354
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:   6
second atom: chain: A, nucl:  67
current score: 53.678
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:   7
second atom: chain: A, nucl:  66
current score: 61.305
--------------------------------------
---------DistanceRestraint, restrsMode: SLOPE --------
first  atom: chain: A, nucl: 8 atom:  P  
second atom: chain: A, nucl: 13 atom:  P  
desired distance should be from 9.100 to 10.100, weight: 0.200
current distance is: 28.457, current score: 3.671
----------------------------
---------DistanceRestraint, restrsMode: SLOPE --------
first  atom: chain: A, nucl: 8 atom:  P  
second atom: chain: A, nucl: 14 atom:  P  
desired distance should be from 9.600 to 10.600, weight: 0.200
current distance is: 34.248, current score: 4.730
----------------------------
---------DistanceRestraint, restrsMode: SLOPE --------
first  atom: chain: A, nucl: 8 atom:  N1 
second atom: chain: A, nucl: 13 atom:  N1 
desired distance should be from 6.300 to 6.900, weight: 0.600
current distance is: 29.853, current score: 13.772
----------------------------
---------DistanceRestraint, restrsMode: SLOPE --------
first  atom: chain: A, nucl: 8 atom:  N1 
second atom: chain: A, nucl: 14 atom:  N9 
desired distance should be from 6.800 to 7.400, weight: 0.600
current distance is: 35.912, current score: 17.107
----------------------------
---------DistanceRestraint, restrsMode: SLOPE --------
first  atom: chain: A, nucl: 8 atom:  P  
second atom: chain: A, nucl: 49 atom:  P  
desired distance should be from 6.000 to 7.000, weight: 0.200
current distance is: 133.963, current score: 25.393
----------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  10
second atom: chain: A, nucl:  25
current score: 61.080
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  11
second atom: chain: A, nucl:  24
current score: 52.835
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  12
second atom: chain: A, nucl:  23
current score: 44.282
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  13
second atom: chain: A, nucl:  22
current score: 35.744
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  27
second atom: chain: A, nucl:  43
current score: 63.558
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  28
second atom: chain: A, nucl:  42
current score: 56.602
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  29
second atom: chain: A, nucl:  41
current score: 48.279
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  30
second atom: chain: A, nucl:  40
current score: 40.157
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  31
second atom: chain: A, nucl:  39
current score: 30.897
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  32
second atom: chain: A, nucl:  38
current score: 22.942
--------------------------------------
---------DistanceRestraint, restrsMode: SLOPE --------
first  atom: chain: A, nucl: 48 atom:  P  
second atom: chain: A, nucl: 50 atom:  P  
desired distance should be from 5.000 to 5.600, weight: 0.600
current distance is: 11.527, current score: 3.556
----------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  49
second atom: chain: A, nucl:  65
current score: 65.293
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  50
second atom: chain: A, nucl:  64
current score: 56.171
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  51
second atom: chain: A, nucl:  63
current score: 48.610
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  52
second atom: chain: A, nucl:  62
current score: 40.414
--------------------------------------
---------SecondStrcRestraint----------
first  atom: chain: A, nucl:  53
second atom: chain: A, nucl:  61
current score: 31.030
--------------------------------------
numberOfNucleotides: 73
initial temperature kT: 1.350000
moves confirmed at first:  4
moves confirmed later: 21
all moves confirmed: 25
percent of confirmed moves: 25.000000

 Time of doing 1 iterations:  0.003 seconds
It seems that the setup is correct
Cmd:
../../../bin/SimRNA -c ../config.dat -R 1 -o f3c68edc-99c2-4950-9efd-0486812f15ae_run_01 -E 10  -S ../seq.ss  -s ../seq.fa  -r ../3l0ussw06rst3_a.rest  -n 4800000  >& r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_01.out
run_02
creating symlink 'data'
making SimRNA run file: r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_02
Cmd:
../../../bin/SimRNA -c ../config.dat -R 2 -o f3c68edc-99c2-4950-9efd-0486812f15ae_run_02 -E 10  -S ../seq.ss  -s ../seq.fa  -r ../3l0ussw06rst3_a.rest  -n 4800000  >& r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_02.out
run_03
creating symlink 'data'
making SimRNA run file: r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_03
Cmd:
../../../bin/SimRNA -c ../config.dat -R 3 -o f3c68edc-99c2-4950-9efd-0486812f15ae_run_03 -E 10  -S ../seq.ss  -s ../seq.fa  -r ../3l0ussw06rst3_a.rest  -n 4800000  >& r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_03.out
run_04
creating symlink 'data'
making SimRNA run file: r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_04
Cmd:
../../../bin/SimRNA -c ../config.dat -R 4 -o f3c68edc-99c2-4950-9efd-0486812f15ae_run_04 -E 10  -S ../seq.ss  -s ../seq.fa  -r ../3l0ussw06rst3_a.rest  -n 4800000  >& r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_04.out
run_05
creating symlink 'data'
making SimRNA run file: r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_05
Cmd:
../../../bin/SimRNA -c ../config.dat -R 5 -o f3c68edc-99c2-4950-9efd-0486812f15ae_run_05 -E 10  -S ../seq.ss  -s ../seq.fa  -r ../3l0ussw06rst3_a.rest  -n 4800000  >& r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_05.out
run_06
creating symlink 'data'
making SimRNA run file: r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_06
Cmd:
../../../bin/SimRNA -c ../config.dat -R 6 -o f3c68edc-99c2-4950-9efd-0486812f15ae_run_06 -E 10  -S ../seq.ss  -s ../seq.fa  -r ../3l0ussw06rst3_a.rest  -n 4800000  >& r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_06.out
run_07
creating symlink 'data'
making SimRNA run file: r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_07
Cmd:
../../../bin/SimRNA -c ../config.dat -R 7 -o f3c68edc-99c2-4950-9efd-0486812f15ae_run_07 -E 10  -S ../seq.ss  -s ../seq.fa  -r ../3l0ussw06rst3_a.rest  -n 4800000  >& r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_07.out
run_08
creating symlink 'data'
making SimRNA run file: r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_08
Cmd:
../../../bin/SimRNA -c ../config.dat -R 8 -o f3c68edc-99c2-4950-9efd-0486812f15ae_run_08 -E 10  -S ../seq.ss  -s ../seq.fa  -r ../3l0ussw06rst3_a.rest  -n 4800000  >&qsub: /usr/bin/qsub /usr/share/man/man1/qsub.1B.gz
qsub: /usr/bin/qsub /usr/share/man/man1/qsub.1B.gz
qsub: /usr/bin/qsub /usr/share/man/man1/qsub.1B.gz
qsub: /usr/bin/qsub /usr/share/man/man1/qsub.1B.gz
qsub: /usr/bin/qsub /usr/share/man/man1/qsub.1B.gz
qsub: /usr/bin/qsub /usr/share/man/man1/qsub.1B.gz
qsub: /usr/bin/qsub /usr/share/man/man1/qsub.1B.gz
qsub: /usr/bin/qsub /usr/share/man/man1/qsub.1B.gz
 r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_08.out
--------------------------------------------------------------------------------
SUBMITTING JOBS:
curr path /home/magnus/SimRNA_automation/WORKING_SPACE/f3c68edc-99c2-4950-9efd-0486812f15ae/run_01
cmd @ cluster /home/oge/bin/lx24-amd64/qsub -cwd -l h_vmem=300M -l mem_free=500M -pe mpi 10 r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_01
Your job 4405349 ("r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_01") has been submitted
curr path /home/magnus/SimRNA_automation/WORKING_SPACE/f3c68edc-99c2-4950-9efd-0486812f15ae/run_02
cmd @ cluster /home/oge/bin/lx24-amd64/qsub -cwd -l h_vmem=300M -l mem_free=500M -pe mpi 10 r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_02
Your job 4405350 ("r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_02") has been submitted
curr path /home/magnus/SimRNA_automation/WORKING_SPACE/f3c68edc-99c2-4950-9efd-0486812f15ae/run_03
cmd @ cluster /home/oge/bin/lx24-amd64/qsub -cwd -l h_vmem=300M -l mem_free=500M -pe mpi 10 r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_03
Your job 4405351 ("r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_03") has been submitted
curr path /home/magnus/SimRNA_automation/WORKING_SPACE/f3c68edc-99c2-4950-9efd-0486812f15ae/run_04
cmd @ cluster /home/oge/bin/lx24-amd64/qsub -cwd -l h_vmem=300M -l mem_free=500M -pe mpi 10 r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_04
Your job 4405352 ("r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_04") has been submitted
curr path /home/magnus/SimRNA_automation/WORKING_SPACE/f3c68edc-99c2-4950-9efd-0486812f15ae/run_05
cmd @ cluster /home/oge/bin/lx24-amd64/qsub -cwd -l h_vmem=300M -l mem_free=500M -pe mpi 10 r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_05
Your job 4405353 ("r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_05") has been submitted
curr path /home/magnus/SimRNA_automation/WORKING_SPACE/f3c68edc-99c2-4950-9efd-0486812f15ae/run_06
cmd @ cluster /home/oge/bin/lx24-amd64/qsub -cwd -l h_vmem=300M -l mem_free=500M -pe mpi 10 r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_06
Your job 4405354 ("r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_06") has been submitted
curr path /home/magnus/SimRNA_automation/WORKING_SPACE/f3c68edc-99c2-4950-9efd-0486812f15ae/run_07
cmd @ cluster /home/oge/bin/lx24-amd64/qsub -cwd -l h_vmem=300M -l mem_free=500M -pe mpi 10 r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_07
Your job 4405355 ("r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_07") has been submitted
curr path /home/magnus/SimRNA_automation/WORKING_SPACE/f3c68edc-99c2-4950-9efd-0486812f15ae/run_08
cmd @ cluster /home/oge/bin/lx24-amd64/qsub -cwd -l h_vmem=300M -l mem_free=500M -pe mpi 10 r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_08
Your job 4405356 ("r_f3c68edc-99c2-4950-9efd-0486812f15ae_run_08") has been submitted
run_SimRNA_prediction .. [OK]