Classifier, supplementary materials, evaluation

Group: fn

bp

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
WW_cis 52 37 58 70 90 205 245 55 658 702 19 32 40 153 169 99 1,388
WW_tran 82 11 6 7 7 67 61 7 23 23 1 5 53 27 30 27 305
WH_cis 4 5 8 16 4 3 66 15 4 9 3 30 2 8 4 181
HW_cis 3 1 11 6 12 3 1 1 3 4 10 34 2 1 92
WH_tran 45 54 22 59 3 6 1 1 22 2 9 224
HW_tran 25 25 37 37 1 1 2 6 8 3 9 154
WS_cis 36 17 9 3 1 6 1 5 16 4 2 3 7 8 11 129
SW_cis 16 4 18 28 37 12 18 7 7 14 3 3 10 27 15 2 221
WS_tran 85 7 54 1 3 9 2 2 4 6 3 176
SW_tran 13 3 16 1 106 3 1 4 9 1 9 5 25 2 198
HH_cis 5 7 1 12
HH_tran 114 5 3 7 4 4 1 4 5 2 136
HS_cis 3 3 1 3 1 5 1 6 1 24
SH_cis 12 6 2 1 8 14 6 5 12 28 73 2 169
HS_tran 16 6 14 63 5 5 2 13 8 132
SH_tran 24 12 9 40 4 5 4 6 15 14 133
SS_cis 24 50 4 13 6 10 10 44
SS_tran 215 261 1 1 58 3 274
Sum 437 141 199 540 637 358 483 92 735 794 47 82 230 327 294 143 3,050

stacking

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
<< 48 21 2 5 112 13 1 7 2 6 217
<> 349 19 11 50 46 44 16 3 17 9 5 1 30 19 6 1 537
>< 15 11 6 29 26 5 12 7 7 5 21 13 6 5 111
>> 474 72 238 349 81 51 191 29 542 121 19 4 160 23 395 15 2,764
Sum 412 123 257 433 265 100 232 3 566 138 29 5 58 57 413 6 1,787

base-phosphate

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
H_0BPh 5 1 1 1 6 2 1 1 4 2 2 2 3 31
S_1BPh 1 2 2 2 7
SW_2BPh 2 1 6 9
W_345BPh 1 3 4 3 11
W_6BPh 2 2 3 1 8
H_789BPh 3 7 1 1 3 4 1 20
Sum 12 2 8 10 8 5 2 3 6 5 1 4 8 4 5 3 86

This is the default dialog which is useful for displaying information. The dialog window can be moved, resized and closed with the 'x' icon.

repr:
Show:
download PDB download JSON