Classifier, supplementary materials, evaluation

Group: fp-consistent-with-single-cl

bp

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
WW_cis 296 296 381 301 385 712 712 448 1,092 1,062 204 231 361 573 587 227 4,510
WW_tran 393 14 44 17 50 43 136 49 36 1 8 95 43 39 34 689
WH_cis 27 1 122 50 111 21 125 28 44 6 84 80 51 10 760
HW_cis 33 26 1 26 4 23 4 31 6 10 58 44 5 271
WH_tran 225 43 132 4 103 71 547 4 108 22 1 4 73 21 2 26 1,386
HW_tran 117 107 97 31 5 304 31 17 5 13 1 23 28 18 23 16 836
WS_cis 96 178 65 320 12 43 2 148 75 103 28 2 120 127 41 45 1,405
SW_cis 108 31 83 54 223 35 59 169 100 78 86 33 126 30 78 31 1,324
WS_tran 8 237 2 2 57 32 60 3 25 102 27 555
SW_tran 20 13 3 5 425 5 8 4 44 21 20 30 45 157 1 801
HH_cis 1 1 1 42 2
HH_tran 138 28 65 34 17 11 14 97 2 15 323
HS_cis 39 42 3 21 81 5 5 2 48 11 257
SH_cis 189 40 140 5 540 5 139 94 51 192 94 672 1 2,162
HS_tran 68 45 9 1,037 99 51 18 161 20 1,508
SH_tran 51 51 77 1,900 144 15 2 63 191 146 2,640
SS_cis 1 20 26 1,114 1,155 135 98 62 248 118 18 95 1,468
SS_tran 438 900 49 28 92 16 3 595
Sum 1,291 936 1,249 3,695 5,830 1,590 2,063 741 1,768 1,742 434 640 1,151 1,739 1,209 369 13,714

stacking

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
<< 254 93 270 248 479 127 327 40 156 275 40 9 288 345 141 22 3,114
<> 1,244 886 1,083 1,421 1,371 1,198 873 62 8,638 9,519 77 108 5,015 2,260 2,585 61 20,862
>< 158 60 156 489 396 382 322 111 404 181 55 96 724 382 838 58 2,823
>> 1,351 1,041 5,222 1,772 1,196 728 3,883 3,838 10,926 910 1,780 1,305 2,525 1,045 7,215 932 45,669
Sum 1,656 2,080 6,731 3,930 3,442 2,435 5,405 213 20,124 10,885 1,952 1,518 6,027 4,032 10,779 141 42,590

This is the default dialog which is useful for displaying information. The dialog window can be moved, resized and closed with the 'x' icon.

repr:
Show:
download PDB download JSON