Classifier, supplementary materials, evaluation

Group: fp-not-recognized-by-others-cl

bp

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
WW_cis 201 238 246 235 381 308 284 531 412 266 148 111 179 333 393 173 2,758
WW_tran 157 14 35 84 61 55 72 10 15 5 3 52 55 12 8 440
WH_cis 81 1 68 5 57 13 45 38 64 5 23 19 2 16 10 447
HW_cis 76 31 1 9 3 18 11 11 3 17 52 16 5 1 1 255
WH_tran 91 7 86 17 51 32 234 23 28 63 2 3 28 16 13 6 700
HW_tran 66 64 31 36 6 132 35 15 9 12 10 6 19 25 5 471
WS_cis 46 62 94 45 8 17 7 15 159 63 10 2 137 100 34 48 847
SW_cis 37 31 9 33 127 13 65 27 57 120 14 26 70 71 63 25 788
WS_tran 2 7 192 2 2 15 5 4 4 12 46 5 296
SW_tran 5 5 228 3 19 1 15 16 25 9 59 16 401
HH_cis 1 1 1 1 11 2
HH_tran 37 14 19 23 5 6 22 19 39 3 102
HS_cis 2 6 2 30 46 2 1 1 36 7 133
SH_cis 90 42 20 3 727 4 67 30 51 87 60 257 2 1,440
HS_tran 100 15 14 333 68 8 1 6 75 24 644
SH_tran 19 45 36 559 173 14 2 21 106 86 1,061
SS_cis 1 2 2 746 404 3 4 56 105 33 7 18 848
SS_tran 142 366 10 20 12 3 3 167
Sum 718 578 671 1,933 2,984 721 1,051 632 849 798 266 286 575 1,025 671 250 7,547

stacking

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
<< 39 38 52 22 59 52 46 5 16 22 7 1 58 34 14 8 473
<> 241 96 81 262 150 96 113 14 353 355 4 31 167 69 72 13 1,315
>< 55 3 37 17 55 72 61 18 53 22 11 22 139 31 44 10 409
>> 253 202 895 295 156 69 499 491 2,569 157 246 97 280 130 876 133 7,348
Sum 335 339 1,065 596 420 289 719 37 2,991 556 268 151 364 264 1,006 31 5,514

base-phosphate

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
H_0BPh 12 10 8 4 34
S_1BPh 0
SW_2BPh 1 1
W_345BPh 1 1
W_6BPh 0
H_789BPh 1 1
Sum 13 1 1 10 8 4 37

base-ribose

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
H_0BR 1 1
S_1BR 0
SW_2BR 0
W_345BR 0
W_6BR 0
H_789BR 0
Sum 1 1

This is the default dialog which is useful for displaying information. The dialog window can be moved, resized and closed with the 'x' icon.

repr:
Show:
download PDB download JSON