Classifier, supplementary materials, evaluation

Group: fp-others

bp

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
WW_cis 5 7 11 1 1 1 2 8 18 13 36
WW_tran 9 1 6 1 5 10 7
WH_cis 5 45 9 3 23 33 1 5 2 126
HW_cis 5 9 1 1 6 1 2 25
WH_tran 7 6 1 1 6 10 4 16 8 3 62
HW_tran 18 3 1 3 13 1 2 1 2 4 48
WS_cis 3 3 7 1 7 3 2 2 14 61 15 118
SW_cis 1 1 2 5 35 1 4 7 6 7 61 16 146
WS_tran 1 4 2 5 6 9 27
SW_tran 2 1 4 7 2 1 17
HH_cis 2 7 2
HH_tran 17 1 8 20 26
HS_cis 11 7 1 1 1 21
SH_cis 2 20 3 1 26
HS_tran 12 2 1 38 82 1 1 9 3 149
SH_tran 2 14 234 20 5 1 36 5 1 318
SS_cis 13 24 4 3 2 17
SS_tran 10 31 1 2 13 24
Sum 49 32 95 97 361 103 57 35 38 47 19 80 33 98 114 33 537

stacking

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
<< 7 5 2 14
<> 3 3
>< 0
>> 0
Sum 7 8 2 17

base-phosphate

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
H_0BPh 1 1 2
S_1BPh 0
SW_2BPh 0
W_345BPh 1 1
W_6BPh 0
H_789BPh 0
Sum 1 1 1 3

base-ribose

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
H_0BR 0
S_1BR 0
SW_2BR 0
W_345BR 1 1
W_6BR 0
H_789BR 0
Sum 1 1

This is the default dialog which is useful for displaying information. The dialog window can be moved, resized and closed with the 'x' icon.

repr:
Show:
download PDB download JSON