Classifier, supplementary materials, evaluation

Group: tp

bp

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
WW_cis 539 491 908 2,494 1,891 26,465 27,877 521 93,913 96,218 582 627 289 15,686 15,235 2,580 143,560
WW_tran 1,774 215 148 4 52 816 839 119 535 520 19 13 295 57 49 519 4,353
WH_cis 61 12 117 60 10 1,815 102 40 16 54 1,169 4 265 116 3,841
HW_cis 12 8 8 253 16 410 5 39 21 31 98 1 469 2 2 12 1,387
WH_tran 1,110 13 1,636 13 46 14 7,231 38 112 24 13 350 66 6 172 10,844
HW_tran 994 892 44 12 26 4,012 12 17 8 36 38 131 38 109 299 6,668
WS_cis 366 642 202 146 6 98 178 234 102 77 119 1 82 140 230 31 2,654
SW_cis 630 165 665 74 481 254 433 238 104 48 46 59 32 203 69 23 3,524
WS_tran 23 1,578 3 147 23 37 56 3 85 41 17 2,013
SW_tran 163 21 10 5 1,255 164 4 5 102 296 25 1 83 47 632 1 2,814
HH_cis 1 1 3 6 32 2 10 4
HH_tran 2,677 19 103 44 15 46 60 172 19 137 5 3,095
HS_cis 75 45 8 37 75 8 1 34 27 310
SH_cis 460 194 52 263 33 168 42 1 348 152 2,087 4 3,804
HS_tran 1,068 131 60 10,182 30 184 4 405 86 12,150
SH_tran 418 172 104 9,929 146 59 12 131 491 525 11,987
SS_cis 4 2 9 996 1,386 8 4 41 446 214 155 469 1,420
SS_tran 1 3,949 5,167 59 49 963 33 5 5,005
Sum 7,699 3,011 3,972 19,904 20,599 32,405 38,816 1,229 95,248 97,900 1,031 1,292 3,804 19,128 17,225 3,435 186,894

stacking

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
<< 3,204 328 446 1,127 3,114 831 1,293 178 1,233 435 337 120 1,384 255 741 237 15,263
<> 20,836 3,017 2,956 15,895 17,507 4,186 2,540 537 14,739 15,529 592 506 35,287 5,046 5,076 584 100,719
>< 2,908 688 1,572 1,149 3,944 1,373 1,690 1,380 1,760 2,197 815 720 6,983 2,365 1,883 807 20,228
>> 42,636 36,276 19,097 48,574 33,727 20,003 9,649 52,095 35,351 66,747 34,207 23,159 98,084 43,672 23,924 14,639 601,840
Sum 26,948 40,309 24,071 66,745 58,292 26,393 15,172 2,095 53,083 84,908 35,951 24,505 43,654 51,338 31,624 1,628 348,144

base-phosphate

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
H_0BPh 986 767 126 789 1,094 557 228 132 344 599 119 285 1,051 415 347 141 7,980
S_1BPh 2,474 2,269 4,055 1,922 10,720
SW_2BPh 1,050 678 1,438 1,034 4,200
W_345BPh 18,226 1,961 2,474 1,047 4,233 5,922 2,084 1,420 37,367
W_6BPh 5,593 983 1,066 1,455 1,343 352 720 230 11,742
H_789BPh 1,136 489 9,634 771 577 2,328 3,753 3,719 4,277 1,615 1,020 1,105 30,424
Sum 8,765 2,917 10,826 4,453 21,794 3,511 4,517 4,237 4,783 5,342 4,626 2,947 9,339 8,259 3,451 2,666 102,433

base-ribose

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
H_0BR 4,835 2,844 2,177 8,144 3,669 4,211 1,148 3,155 2,685 2,648 2,383 1,676 4,431 4,188 3,242 1,777 53,213
S_1BR 2,733 3,202 3,656 1,803 11,394
SW_2BR 4,229 4,686 5,635 3,842 18,392
W_345BR 1,713 555 1,324 421 2,380 1,057 885 260 8,595
W_6BR 2,308 2,199 384 15,658 1,267 323 423 381 22,943
H_789BR 585 820 1,680 3,346 988 969 1,139 2,957 1,952 476 1,855 1,026 17,793
Sum 11,957 10,549 4,241 32,783 8,115 10,308 2,672 4,617 6,065 7,174 4,716 2,573 10,467 7,048 5,982 3,063 132,330

This is the default dialog which is useful for displaying information. The dialog window can be moved, resized and closed with the 'x' icon.

repr:
Show:
download PDB download JSON