Classifier, supplementary materials, training set

bp

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
WW_cis 190 753 753 1,088 1,088 18,988 18,988 628 57,896 57,896 329 329 33 8,028 8,028 1,137 89,070
WW_tran 674 96 96 16 16 527 527 18 406 406 59 59 25 116 116 112 2,049
WH_cis 18 18 6 125 91 4 849 128 65 5 1 31 460 2 141 33 1,977
HW_cis 18 6 18 91 125 849 4 128 5 65 31 1 460 141 2 33 1,977
WH_tran 664 14 934 25 26 12 3,541 77 90 8 4 3 214 24 11 124 5,771
HW_tran 664 934 14 26 25 3,541 12 77 8 90 3 4 214 11 24 124 5,771
WS_cis 404 713 278 269 11 195 252 271 79 83 63 19 92 195 121 20 3,065
SW_cis 404 278 713 11 269 252 195 271 83 79 19 63 92 121 195 20 3,065
WS_tran 75 52 42 1,184 11 3 200 29 156 41 1 4 12 253 120 6 2,189
SW_tran 75 42 52 11 1,184 200 3 29 41 156 4 1 12 120 253 6 2,189
HH_cis 4 3 3 4 4 8 8 5 5 0 0 24
HH_tran 1,325 76 76 65 65 162 162 2 151 151 19 19 2 1,802
HS_cis 315 11 110 102 1 119 2 50 6 182 1 95 1,179 12 2,185
SH_cis 315 110 11 1 102 2 119 50 6 1 182 95 1,179 12 2,185
HS_tran 447 210 116 7,449 1 91 1 158 2 1 237 1 213 1 307 1 9,236
SH_tran 447 116 210 1 7,449 1 91 158 1 2 1 237 213 307 1 1 9,236
SS_cis 6 5 5 989 989 5 5 161 161 72 219 219 1,457
SS_tran 4 3,664 3,664 20 20 402 50 50 4,140
Sum 4,126 3,437 3,437 15,121 15,121 24,959 24,959 1,361 59,175 59,175 954 954 1,620 10,767 10,767 1,445 122,965

stacking

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
<< 13,927 7,747 13,968 12,380 16,609 3,708 7,141 16,955 19,351 12,464 8,886 11,091 27,269 8,268 13,742 4,949 198,455
<> 6,968 2,933 2,933 10,895 10,895 2,579 2,579 203 9,509 9,509 313 313 10,491 3,506 3,506 301 47,698
>< 1,170 1,132 1,132 1,729 1,729 985 985 524 943 943 642 642 2,234 1,456 1,456 232 11,047
>> 13,927 13,968 7,747 16,609 12,380 7,141 3,708 16,955 12,464 19,351 11,091 8,886 27,269 13,742 8,268 4,949 198,455
Sum 22,065 25,780 25,780 41,613 41,613 14,413 14,413 17,682 42,267 42,267 20,932 20,932 39,994 26,972 26,972 5,482 257,200

base-phosphate

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
H_0BPh 256 220 40 255 326 189 41 67 130 369 26 44 251 67 48 17 2,346
S_1BPh 839 602 1,024 500 2,965
SW_2BPh 167 113 842 324 1,446
W_345BPh 6,126 746 916 430 1,289 2,251 950 495 13,203
W_6BPh 1,854 503 300 323 416 83 288 75 3,842
H_789BPh 254 298 2,907 250 206 719 1,177 1,014 1,510 378 234 317 9,264
Sum 2,531 1,134 3,247 1,670 7,291 1,135 1,506 1,327 1,432 1,887 1,611 852 2,564 2,818 1,232 829 33,066

base-ribose

show selected    +clear selection    +select all
Desc AAACCAAGGAAUUACCCGGCCUUCGGGUUGUU Sum
H_0BR 1,022 846 373 2,332 662 1,058 279 442 416 499 624 360 593 821 731 342 11,400
S_1BR 999 478 1,101 583 3,161
SW_2BR 1,292 1,048 1,732 1,337 5,409
W_345BR 252 75 368 212 856 506 173 129 2,571
W_6BR 938 578 85 5,990 484 101 214 160 8,550
H_789BR 173 335 686 1,400 355 353 416 781 542 261 536 355 6,193
Sum 3,425 2,807 1,144 11,454 1,913 3,234 707 959 1,411 1,345 1,326 833 2,550 1,910 1,440 826 37,284

This is the default dialog which is useful for displaying information. The dialog window can be moved, resized and closed with the 'x' icon.

repr:
Show:
download PDB download JSON