Home
Submit
All results

ModeRNA
Help
Tutorial
Contact

Genesilico Homepage

The results of your job 'test1' are ready.


Provided sequence:
GGCCGAAGCCUUCGGGAAUAAGGCC

Results for the structures of the resolution better than 2.5 Å:


Rfam Family PDB ID Alingment Identity Similarity .aln file .pdb file
RF00167 2B57_A
>Target   GGCCGAAGCCUUCGGGAAUAAGGCC----------------------------------------
>2B57 A   GACAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGAUUAUGUC
0.185
0.223
RF00167 2G9C_A
>Target   GGCCGAAGCCUUCG-GGAAUAAGGCC-----------------------------------------
>2G9C A   GGACAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGAUUAUGUCC
0.179
0.201
RF00167 3FO6_A
>Target   GGCCGAAGCCUUCG-GGAAUAAGGCC-----------------------------------------
>3FO6 A   GGACAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACUAUGUCC
0.179
0.201
RF00167 3GAO_A
>Target   GGCCGAAGCCUUCG-GGAAUAAGGCC-----------------------------------------
>3GAO A   GGACAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACUAUGUCC
0.179
0.201
RF00167 3GES_A
>Target   GGCCGAAGCCUUCG-GGAAUAAGGCC-----------------------------------------
>3GES A   GGACAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGAUUAUGUCC
0.179
0.201
RF00167 2EEU_A
>Target   GGCCGAAGCCUUCG-GGAAUAAGGCC-----------------------------------------
>2EEU A   GGACAUAAAAUCGCGUGGAUAUGGCACGCAAGUUUCUUCCGGGCACCGUAAAUGUCCGACUAUGUCC
0.179
0.209
RF00167 1U8D_A
>Target   GGCCGAAGCCUUCG-GGAAUAAGGCC-----------------------------------------
>1U8D A   GGACAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACUAUGUCC
0.179
0.201
RF00167 3GOT_A
>Target   GGCCGAAGCCUUCG-GGAAUAAGGCC-----------------------------------------
>3GOT A   GGACAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGAUUAUGUCC
0.179
0.201
RF00167 2EEW_A
>Target   GGCCGAAGCCUUCG-GGAAUAAGGCC-----------------------------------------
>2EEW A   GGACAUAUAAUCGCGUGGAUAUGGCACGCAAGCUUCUACCGGGCACCGUAAAUGUCCGACUAUGUCC
0.179
0.201
RF00167 2EEV_A
>Target   GGCCGAAGCCUUCG-GGAAUAAGGCC-----------------------------------------
>2EEV A   GGACAUACAAUCGCGUGGAUAUGGCACGCAAGUUUCUGCCGGGCACCGUAAAUGUCCGACUAUGUCC
0.179
0.201
RF00167 3GER_A
>Target   GGCCGAAGCCUUCG-GGAAUAAGGCC-----------------------------------------
>3GER A   GGACAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACUAUGUCC
0.179
0.201
RF00167 3G4M_A
>Target   GGCCGAAGCCUUCG-GGAAUAAGGCC-----------------------------------------
>3G4M A   GGACAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACUAUGUCC
0.179
0.201
RF00167 3DS7_A
>Target   GGCCGAAGCCUUCG-GGAAUAAGGCC------------------------------------------
>3DS7 A   GGACAUACAAUCGCGUGGAUAUGGCACGCAAGAUCCCGCCGGGCACCGUAAAUGUCCGACUAUGUCCg
0.176
0.199
RF00167 3DS7_B
>Target   GGCCGAAGCCUUCG-GGAAUAAGGCC------------------------------------------
>3DS7 B   GGACAUACAAUCGCGUGGAUAUGGCACGCAAGAUCCCGCCGGGCACCGUAAAUGUCCGACUAUGUCCg
0.176
0.199
RF00167 3FO4_A
>Target   GGCCGAAGCCUUCGGGAAUAAGGCC---------------------------------------
>3FO4 A   -ACAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGAUUAUGU
0.175
0.214
RF00167 3GOG_A
>Target   GGCCGAAGCCUUCGGGAAUAAGGCC----------------------------------------
>3GOG A   GACAUGUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACCAUGUC
0.169
0.215
RF00167 2EET_A
>Target   GGCCGAAGCCUUCG-GGAAUAAGGCC-----------------------------------------
>2EET A   GGACAUGUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACCAUGUCC
0.164
0.194
RF00167 2EES_A
>Target   GGCCGAAGCCUUCG-GGAAUAAGGCC-----------------------------------------
>2EES A   GGACAUUUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACAAUGUCC
0.164
0.187
RF00167 1Y27_X
>Target   GGCCGAAGCCUUCG-GGAAUAAGGCC-----------------------------------------
>1Y27 X   GAUCAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACUAUGGUC
0.164
0.201
RF00167 1Y26_X
>Target   GGCCGAAGCCUUCG---GGAAUAAGGCC-------------------------------------------
>1Y26 X   CGCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUGAAGUG
0.113
0.162
RF00002 3CC2_0
>Target   GGC----------------------------------------CGAAGCC---UUCG------------------------------------GGAAU-----AAGG-------C-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---------------------------------
>3CC2 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCUGUGGGGAGCCGCACGGAGGCGAAGAACCACAGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAACGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUUCACGAAGUCUCUUGGAAUAGAGCGUGAUACAGGGUGACAACCCCGUACUGAAGACCAGUACGCUGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUUGACGAAUGACCGAGACGCGAGUCUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGUAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCUGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGCAGGGGCGAGAGCUCCUGUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCUCACCGCAACUCGACUGAGACGAAAUGGGAAACAGGUUAAUAUUCCUGUGCCAUCAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCCGGGCAUCGCCCGGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUGAUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGUCAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUGACUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.005
0.006
RF00002 1YHQ_0
>Target   GGC----------------------------------------CGAAGCC---UUCG------------------------------------GGAAU-----AAGG-------C-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------C---------------------------------
>1YHQ 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCUGUGGGGAGCCGCACGGAGGCGAAGAACCACAGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAACGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUUCACGAAGUCUCUUGGAAUAGAGCGUGAUACAGGGUGACAACCCCGUACUGAAGACCAGUACGCUGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUUGACGAAUGACCGAGACGCGAGUCUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGUAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCUGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGCAGGGGCGAGAGCUCCUGUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCUCACCGCAACUCGACUGAGACGAAAUGGGAAACAGGUUAAUAUUCCUGUGCCAUCAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCCGGGCAUCGCCCGGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUGAUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCAAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGUCAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUGACUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.005
0.006
RF00177 3CC2_0
>Target   G----------G----------------------------------------------------------CC----------GA-----A-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GC-----------------C-----------------------UU--------------------------------------------------C----------------------G-------------G------------------G---------------AAUA-----------------------------------------A------GGC-------------------C---------------------
>3CC2 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCUGUGGGGAGCCGCACGGAGGCGAAGAACCACAGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAACGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUUCACGAAGUCUCUUGGAAUAGAGCGUGAUACAGGGUGACAACCCCGUACUGAAGACCAGUACGCUGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUUGACGAAUGACCGAGACGCGAGUCUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGUAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCUGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGCAGGGGCGAGAGCUCCUGUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCUCACCGCAACUCGACUGAGACGAAAUGGGAAACAGGUUAAUAUUCCUGUGCCAUCAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCCGGGCAUCGCCCGGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUGAUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGUCAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUGACUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.004
0.004
RF00177 1FFK_0
>Target   G----------G----------------------------------------------------------CC----------GA----A---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GC--------------C---------------------UU------------------------------------------C-------------------------G-------------G------------G----------AAUA-------A------GGC-------------------C---------------------
>1FFK 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUGAAAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUUGUUCGCCUAUUAAAGGAGGUCGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.004
0.004
RF00177 1YHQ_0
>Target   G----------G----------------------------------------------------------CC----------GA-----A-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GC-----------------C-----------------------UU--------------------------------------------------C----------------------G-------------G------------------G---------------AAUA-----------------------------------------A------GGC-------------------C---------------------
>1YHQ 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCUGUGGGGAGCCGCACGGAGGCGAAGAACCACAGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAACGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUUCACGAAGUCUCUUGGAAUAGAGCGUGAUACAGGGUGACAACCCCGUACUGAAGACCAGUACGCUGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUUGACGAAUGACCGAGACGCGAGUCUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGUAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCUGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGCAGGGGCGAGAGCUCCUGUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCUCACCGCAACUCGACUGAGACGAAAUGGGAAACAGGUUAAUAUUCCUGUGCCAUCAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCCGGGCAUCGCCCGGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUGAUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCAAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGUCAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUGACUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.004
0.004
RF00177 1S72_0
>Target   G----------G--------------------------------CC----------GA---A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GC-----------------C-----------------------UU----------------------------------------------------C--------------------G-------------G------------------G---------------AAU--A---------------------------------------A------GGC-------------------C---------------------
>1S72 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.003
0.005
RF00177 1VQL_0
>Target   G----------G--------------------------------CC----------GA---A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GC-----------------C-----------------------UU----------------------------------------------------C--------------------G-------------G------------------G---------------AAU--A---------------------------------------A------GGC-------------------C---------------------
>1VQL 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.003
0.005
RF00177 1VQM_0
>Target   G----------G--------------------------------CC----------GA---A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GC-----------------C-----------------------UU----------------------------------------------------C--------------------G-------------G------------------G---------------AAU--A---------------------------------------A------GGC-------------------C---------------------
>1VQM 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.003
0.005
RF00177 1VQ8_0
>Target   G----------G--------------------------------CC----------GA---A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GC-----------------C-----------------------UU----------------------------------------------------C--------------------G-------------G------------------G---------------AAU--A---------------------------------------A------GGC-------------------C---------------------
>1VQ8 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.003
0.005
RF00177 1VQP_0
>Target   G----------G--------------------------------CC----------GA---A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GC-----------------C-----------------------UU----------------------------------------------------C--------------------G-------------G------------------G---------------AAU--A---------------------------------------A------GGC-------------------C---------------------
>1VQP 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.003
0.005
RF00177 1VQO_0
>Target   G----------G--------------------------------CC----------GA---A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GC-----------------C-----------------------UU----------------------------------------------------C--------------------G-------------G------------------G---------------AAU--A---------------------------------------A------GGC-------------------C---------------------
>1VQO 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.003
0.005
RF00177 1VQ9_0
>Target   G----------G--------------------------------CC----------GA---A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GC-----------------C-----------------------UU----------------------------------------------------C--------------------G-------------G------------------G---------------AAU--A---------------------------------------A------GGC-------------------C---------------------
>1VQ9 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.003
0.005
RF00177 1VQN_0
>Target   G----------G--------------------------------CC----------GA---A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GC-----------------C-----------------------UU----------------------------------------------------C--------------------G-------------G------------------G---------------AAU--A---------------------------------------A------GGC-------------------C---------------------
>1VQN 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.003
0.005
RF00177 1JJ2_0
>Target   G----------G--------------------------------CC----------GA---A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GC-----------------C-----------------------UU----------------------------------------------------C--------------------G-------------G------------------G---------------AAU--A---------------------------------------A------GGC-------------------C---------------------
>1JJ2 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUGAAAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUUGUUCGCCUAUUAAAGGAGGUCGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.003
0.005
RF00177 1VQK_0
>Target   G----------G--------------------------------CC----------GA---A-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GC-----------------C-----------------------UU----------------------------------------------------C--------------------G-------------G------------------G---------------AAU--A---------------------------------------A------GGC-------------------C---------------------
>1VQK 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.003
0.005

RFAM families found for your sequence with PDB structures with the resolution worse than 2.5 Å:
Valid HTML 4.01! Made with Django.