Home
Submit
All results

ModeRNA
Help
Tutorial
Contact

Genesilico Homepage

The results of your job 'tRNA' are ready.


Provided sequence: NC0129201:C5655-5587HOMOSAPIENSMITOCHONDRION,COMPLETEGENOMEAAGGGCTTAGCTTAATTAAAGTGGCTGATTTGCGTTCAGTTGATGCAGAGTGGGGTTTTGCAGTCCTTA

ModeRNA could not find templates because of the errors:

NO templates found. Paralign did not return any results
Valid HTML 4.01! Made with Django.