Home
Submit
All results

ModeRNA
Help
Tutorial
Contact

Genesilico Homepage

The results of your job '5S' are ready.


Structure after analysis:
[5S.pdb]

Modifications:

There are no modifications in the structure.
Download: [.txt file with all modifications]

Sequence of a given structure:

UUAGGCGGCCACAGCGGUGGGGUUGCCUCCCGUACCCAUCCCGAACACGG
AAGAUAAGCCCACCAGCGUUCCAGGGAGUACUGGAGUGCGCGAGCCUCUG
GGAAAUCCGGUUCGCCGCCACC
Download: [.fasta file with the sequence]

Secondary structure of a given structure:

...((((((....((((((((......((((((...(.....)...))))
..))....)))))).))...((.(......((((((.((....)))))))
).....).))...))))))...

Java Get Powered

Download: [.vienna file with the secondary structure]

Geometry of the structure:

        
Unusual dihedral angles:
- Residues 22 --- 23 (X:O3',X+1:P,X+1:O5',X+1:C5'): 12.52
- Residues 39 --- 40 (X:O3',X+1:P,X+1:O5',X+1:C5'): 10.72
- Residues 66 --- 65 (X:C4',X:C3',X:O3',X+1:P): 129.70



    
Valid HTML 4.01! Made with Django.