Home
Submit
All results

ModeRNA
Help
Tutorial
Contact

Genesilico Homepage

The results of your job '2H-test2' are ready.


Structure after analysis:
[2H-test2.cleaned.pdb]

Sequence of a given structure:

CGUAUGCAUGCGAUCGAGCUACUUCGGUAGCUCGAUCGAUCGAGCUACUU
CGGUAGCUCGAUCGCUGCUGAAGCGCGCACGGCAGCGCAUGCAUACGCGU
CAUCGCAUAUGCUGAAGCGCGCACGGCAUCGCAUCGCAUCUUCGGAUGCG
AUGCGCGCAUCGCAUCUUCGGAUGCGAUGCGAUGCGAUGACG
Download: [.fasta file with the sequence]

Secondary structure of a given structure:

((((((((((((((((((((((....)))))))))))(((((((((((..
..)))))))))))(((((((.........))))))))))))))))))(((
((((((((((((((.........))))))(((((((((((....))))))
)))))(((((((((((....))))))))))))))))))))))

Java Get Powered

Download: [.vienna file with the secondary structure]

Geometry of the structure:

        
Unusual bond angles:
- Residues 26 --- 25 (X:C3',X:O3',X+1:P): 145.69
- Residues 37 --- 38 (X:C3',X:O3',X+1:P): 153.99
- Residues 51 --- 52 (X:C3',X:O3',X+1:P): 145.96
- Residues 73 --- 72 (X:C3',X:O3',X+1:P): 140.70
- Residues 86 --- 87 (X:C3',X:O3',X+1:P): 153.26
- Residues 108 --- 109 (X:C3',X:O3',X+1:P): 167.80
- Residues 117 --- 116 (X:C3',X:O3',X+1:P): 144.43
- Residues 144 --- 143 (X:C3',X:O3',X+1:P): 146.75
- Residues 155 --- 156 (X:C3',X:O3',X+1:P): 159.21
- Residues 170 --- 169 (X:C3',X:O3',X+1:P): 146.31

Unusual dihedral angles:
- Residues 22 --- 23 (X:O3',X+1:P,X+1:O5',X+1:C5'): 341.56
- Residues 48 --- 49 (X:O3',X+1:P,X+1:O5',X+1:C5'): 346.09
- Residues 71 --- 72 (X:O3',X+1:P,X+1:O5',X+1:C5'): 341.65
- Residues 73 --- 72 (X:O3',X+1:P,X+1:O5',X+1:C5'): 1.02
- Residues 115 --- 116 (X:O3',X+1:P,X+1:O5',X+1:C5'): 348.12
- Residues 140 --- 141 (X:O3',X+1:P,X+1:O5',X+1:C5'): 345.69
- Residues 155 --- 154 (X:O3',X+1:P,X+1:O5',X+1:C5'): 353.71
- Residues 166 --- 167 (X:O3',X+1:P,X+1:O5',X+1:C5'): 345.48
- Residues 37 --- 38 (X:C4',X:C3',X:O3',X+1:P): 87.36
- Residues 86 --- 87 (X:C4',X:C3',X:O3',X+1:P): 88.28
- Residues 155 --- 156 (X:C4',X:C3',X:O3',X+1:P): 100.38
- Residue 23 (X:O5',X:C5',X:C4',X:C3'): 13.95
- Residue 38 (X:O5',X:C5',X:C4',X:C3'): 137.00
- Residue 49 (X:O5',X:C5',X:C4',X:C3'): 10.00
- Residue 71 (X:O5',X:C5',X:C4',X:C3'): 250.43
- Residue 115 (X:O5',X:C5',X:C4',X:C3'): 241.71
- Residue 141 (X:O5',X:C5',X:C4',X:C3'): 10.86
- Residue 155 (X:O5',X:C5',X:C4',X:C3'): 17.91
- Residue 156 (X:O5',X:C5',X:C4',X:C3'): 345.40
- Residue 167 (X:O5',X:C5',X:C4',X:C3'): 15.26



    
Valid HTML 4.01! Made with Django.