Home
Submit
All results

ModeRNA
Help
Tutorial
Contact

Genesilico Homepage

The results of your job 'testRNA' are ready.


Provided sequence:
GGUAAGUGUAAAAACACAAUUGGGUUGGUAGUCCCAAUGCAGUGA

Results for the structures of the resolution better than 2.5 Å:


Rfam Family PDB ID Alingment Identity Similarity .aln file .pdb file
RF00005 1N78_D
>Target   ----------------GGU-A----AGU-----GUAAA--AACACAAUUGGGUUGGUAGUCCCAAUGCAG---UGA
>1N78 D   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCG-AUUCCCCCUGGGGUCACCA
0.32
0.34
RF00005 2DXI_D
>Target   ----------------GGU-A----AGU-----GUAAA--AACACAAUUGGGUUGGUAGUCCCAAUGCAG---UGA
>2DXI D   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCG-AUUCCCCCUGGGGUCACCA
0.32
0.34
RF00005 1N77_D
>Target   ----------------GGU-A----AGU-----GUAAA--AACACAAUUGGGUUGGUAGUCCCAAUGCAG---UGA
>1N77 D   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCG-AUUCCCCCUGGGGUCACCA
0.32
0.34
RF00005 2DXI_C
>Target   ----------------GGU-A----AGU-----GUAAA--AACACAAUUGGGUUGGUAGUCCCAAUGCAG---UGA
>2DXI C   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCG-AUUCCCCCUGGGGUCACCA
0.32
0.34
RF00005 2CV1_C
>Target   ----------------GGU-A----AGU-----GUAAA--AACACAAUUGGGUUGGUAGUCCCAAUGCAG---UGA
>2CV1 C   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCG-AUUCCCCCUGGGGUCACCA
0.32
0.34
RF00005 2CV0_D
>Target   ----------------GGU-A----AGU-----GUAAA--AACACAAUUGGGUUGGUAGUCCCAAUGCAG---UGA
>2CV0 D   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCG-AUUCCCCCUGGGGUCACCA
0.32
0.34
RF00005 1N78_C
>Target   ----------------GGU-A----AGU-----GUAAA--AACACAAUUGGGUUGGUAGUCCCAAUGCAG---UGA
>1N78 C   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCG-AUUCCCCCUGGGGUCACCA
0.32
0.34
RF00005 1N77_C
>Target   ----------------GGU-A----AGU-----GUAAA--AACACAAUUGGGUUGGUAGUCCCAAUGCAG---UGA
>1N77 C   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCG-AUUCCCCCUGGGGUCACCA
0.32
0.34
RF00005 2CV1_D
>Target   ----------------GGU-A----AGU-----GUAAA--AACACAAUUGGGUUGGUAGUCCCAAUGCAG---UGA
>2CV1 D   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCG-AUUCCCCCUGGGGUCACCA
0.32
0.34
RF00005 2CV0_C
>Target   ----------------GGU-A----AGU-----GUAAA--AACACAAUUGGGUUGGUAGUCCCAAUGCAG---UGA
>2CV0 C   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCG-AUUCCCCCUGGGGUCACCA
0.32
0.34
RF00005 1G59_B
>Target   ----------------GGU-A----AGU-----GUAAA--AACACAAUUGGGUUGGUAGUCCCAAUGCAG---UGA
>1G59 B   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCG-AUUCCCCCUGGGGUCACCA
0.32
0.34
RF00005 1G59_D
>Target   ----------------GGU-A----AGU-----GUAAA--AACACAAUUGGGUUGGUAGUCCCAAUGCAG---UGA
>1G59 D   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCG-AUUCCCCCUGGGGUCACCA
0.32
0.34
RF00005 1U0B_A
>Target   ----------------GGUA----AGU-----GUAAA--AACACAAUUGGGUUGGUAGUCCCAAUGCAGUG---A
>1U0B A   GGCGCGUUAACAAAGCGGUUAUGUAGCGGAUUGCAAAUCCGUCUAGUCCGGUUCG-ACUCCGGAACGCGCCUCCA
0.311
0.372
RF00005 1J1U_B
>Target   ------------------GGUA----AGU-----GUAAA--AACACA-AUUGGGUUGGUAGUCCCAAUGCAGUGA
>1J1U B   CCGGCGGUAGUUCAGCCUGGUAGAACGGCGGACUGUAGAUCCGCAUGUCGCUGGUUCA-AAUCCGGCCCGCCGGA
0.284
0.358
RF00005 1QTQ_B
>Target   ---------------GGUA----AGU-----GUAAA--AACACA-AUUGGGUUGGUAGUCCCAAUGCAGUG---A
>1QTQ B   GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCG-AAUCCUCGUACCCCAGCCA
0.257
0.331
RF00005 1QU2_T
>Target   -----------------GGU-A----AGU-----GUAAA--AACACA-AUUGGGUUGGUAGUCCCAAUGCAGUGA-
>1QU2 T   GGGCUUGUAGCUCAGGUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGGUGGUUCA-AGUCCACUCAGGCCCAC
0.24
0.293
RF00005 1FFY_T
>Target   -----------------GGU-A----AGU-----GUAAA--AACACA-AUUGGGUUGGUAGUCCCAAUGCAGUGA-
>1FFY T   GGGCUUGUAGCUCAGGUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGGUGGUUCA-AGUCCACUCAGGCCCAC
0.24
0.293
RF00005 2ZUE_B
>Target   ------------------GGU-A----AGU-----GUAAA--AACACA-AUUGGGUUGGUAGUCCCAAUGCAGUG-A
>2ZUE B   GGACCGGUAGCCUAGCCAGGACAGGGCGGCGGCCUCCUAAGCCGCAGGUCCGGGGUUCA-AAUCCCCGCCGGUCCGC
0.237
0.316
RF00005 2ZUF_B
>Target   ------------------GGU-A----AGU-----GUAAA--AACACA-AUUGGGUUGGUAGUCCCAAUGCAGUG-A
>2ZUF B   GGACCGGUAGCCUAGCCAGGACAGGGCGGCGGCCUCCUAAGCCGCAGGUCCGGGGUUCA-AAUCCCCGCCGGUCCGC
0.237
0.316
RF00005 1C0A_B
>Target   -----------------GGU-A----AGU-----GUAAA--AACACA-AUUGGGUUGGUAGUCCCAAUGCAGUG---A
>1C0A B   GGAGCGG4AGUUCAGDCGGDDAGAAUACCUGCCUQUCACGCAGGGG7UCGCGGGTPCG-AGUCCCGPCCGUUCCGCCA
0.234
0.332
RF00005 1F7U_B
>Target   ----------------GGU-A----AGU-----GUAAA--AACACA-AUUGGGUUGGUAGUCCCAAUGCAGUG---A
>1F7U B   PUCCUCGUKLCCCAADGGDCACGGCRPCUGGCUICGAACCAGAAGADU?CAGGTPCA-"GUCCUGGCGGGGAAGCCA
0.224
0.376
RF00005 1EHZ_A
>Target   -----------------GGUA----AGU-----GUAAA--AACACA-AUUGGGUUGGUAGUCCCAAUGCAGUG---A
>1EHZ A   GCGGAUUUALCUCAGDDGGGAGAGCRCCAGABU#AAYAP?UGGAG7UC?UGUGTPCG-"UCCACAGAAUUCGCACCA
0.184
0.297
RF00005 1EVV_A
>Target   -----------------GGUA----AGU-----GUAAA--AACACA-AUUGGGUUGGUAGUCCCAAUGCAGUG---A
>1EVV A   GCGGAUUUALCUCAGDDGGGAGAGCRCCAGABU#AAYAP?UGGAG7UC?UGUGTPCG-"UCCACAGAAUUCGCACCA
0.184
0.297
RF00017 1LNG_B
>Target   GGUAAGUGUAAAAA-CACAA--U-----UGGGUUGGUAG----UCC----------------------------CAA---UG------CA-------GUGA
>1LNG B   UCGGCG-GUGG--GGGAGCAUCUCCUGUAGGGGA-GAUGUAACCCCCUUUACCUGCCGAACCCCGCCAGGCCCGGAAGGGAGCAACGGUAGGCAGGACGUC
0.175
0.206
RF00177 1FFK_0
>Target   -----------------------------------------------------------------------G--GUAA--GUGU-------------------------AAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A----------------------A------------------------------------------CACA------------------AUU---GG-------GUUGG-----------U----AGUCCCAAU-------------------------------------G----------CAGUGA-----
>1FFK 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUGAAAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUUGUUCGCCUAUUAAAGGAGGUCGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.006
0.009
RF00177 3CC2_0
>Target   -----------------------------------------------------------------------G--GUAA--GUGU-------------------------------------------------------AAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A------------------------A--------------------------------------------------CAC--A--------AUU-----------GG----GUUGG-----------------U-----AGUCCC----AAU-----------------------------------------------------------------------G----------CAGUGA-----
>3CC2 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCUGUGGGGAGCCGCACGGAGGCGAAGAACCACAGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAACGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUUCACGAAGUCUCUUGGAAUAGAGCGUGAUACAGGGUGACAACCCCGUACUGAAGACCAGUACGCUGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUUGACGAAUGACCGAGACGCGAGUCUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGUAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCUGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGCAGGGGCGAGAGCUCCUGUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCUCACCGCAACUCGACUGAGACGAAAUGGGAAACAGGUUAAUAUUCCUGUGCCAUCAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCCGGGCAUCGCCCGGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUGAUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGUCAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUGACUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.004
0.007
RF00177 1VQL_0
>Target   ---------------------------------------------G--GUAA--GUGU---------------------------------------------AAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A------------------------A----------------------------------------------------CACA--------AUU-----------GG----GUUGG-----------------U-----AGUCCC----AAU-----------------------------------------------------------------------G----------CAGUGA-----
>1VQL 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.004
0.007
RF00177 1VQM_0
>Target   ---------------------------------------------G--GUAA--GUGU---------------------------------------------AAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A------------------------A----------------------------------------------------CACA--------AUU-----------GG----GUUGG-----------------U-----AGUCCC----AAU-----------------------------------------------------------------------G----------CAGUGA-----
>1VQM 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.004
0.007
RF00177 1VQP_0
>Target   ---------------------------------------------G--GUAA--GUGU---------------------------------------------AAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A------------------------A----------------------------------------------------CACA--------AUU-----------GG----GUUGG-----------------U-----AGUCCC----AAU-----------------------------------------------------------------------G----------CAGUGA-----
>1VQP 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.004
0.007
RF00177 1YHQ_0
>Target   -----------------------------------------------------------------------G--GUAA--GUGU-------------------------------------------------------AAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A------------------------A--------------------------------------------------CAC--A--------AUU-----------GG----GUUGG-----------------U-----AGUCCC----AAU-----------------------------------------------------------------------G----------CAGUGA-----
>1YHQ 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCUGUGGGGAGCCGCACGGAGGCGAAGAACCACAGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAACGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUUCACGAAGUCUCUUGGAAUAGAGCGUGAUACAGGGUGACAACCCCGUACUGAAGACCAGUACGCUGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUUGACGAAUGACCGAGACGCGAGUCUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGUAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCUGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGCAGGGGCGAGAGCUCCUGUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCUCACCGCAACUCGACUGAGACGAAAUGGGAAACAGGUUAAUAUUCCUGUGCCAUCAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCCGGGCAUCGCCCGGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUGAUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCAAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGUCAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUGACUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.004
0.007
RF00177 1S72_0
>Target   ---------------------------------------------G--GUAA--GUGU---------------------------------------------AAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A------------------------A----------------------------------------------------CACA--------AUU-----------GG----GUUGG-----------------U-----AGUCCC----AAU-----------------------------------------------------------------------G----------CAGUGA-----
>1S72 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.004
0.007
RF00177 1VQ8_0
>Target   ---------------------------------------------G--GUAA--GUGU---------------------------------------------AAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A------------------------A----------------------------------------------------CACA--------AUU-----------GG----GUUGG-----------------U-----AGUCCC----AAU-----------------------------------------------------------------------G----------CAGUGA-----
>1VQ8 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.004
0.007
RF00177 1VQO_0
>Target   ---------------------------------------------G--GUAA--GUGU---------------------------------------------AAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A------------------------A----------------------------------------------------CACA--------AUU-----------GG----GUUGG-----------------U-----AGUCCC----AAU-----------------------------------------------------------------------G----------CAGUGA-----
>1VQO 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.004
0.007
RF00177 1VQ9_0
>Target   ---------------------------------------------G--GUAA--GUGU---------------------------------------------AAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A------------------------A----------------------------------------------------CACA--------AUU-----------GG----GUUGG-----------------U-----AGUCCC----AAU-----------------------------------------------------------------------G----------CAGUGA-----
>1VQ9 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.004
0.007
RF00177 1VQN_0
>Target   ---------------------------------------------G--GUAA--GUGU---------------------------------------------AAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A------------------------A----------------------------------------------------CACA--------AUU-----------GG----GUUGG-----------------U-----AGUCCC----AAU-----------------------------------------------------------------------G----------CAGUGA-----
>1VQN 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.004
0.007
RF00177 1JJ2_0
>Target   ---------------------------------------------G--GUAA--GUGU---------------------------------------------AAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A------------------------A----------------------------------------------------CACA--------AUU-----------GG----GUUGG-----------------U-----AGUCCC----AAU-----------------------------------------------------------------------G----------CAGUGA-----
>1JJ2 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUGAAAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUUGUUCGCCUAUUAAAGGAGGUCGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.004
0.007
RF00177 1VQK_0
>Target   ---------------------------------------------G--GUAA--GUGU---------------------------------------------AAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A------------------------A----------------------------------------------------CACA--------AUU-----------GG----GUUGG-----------------U-----AGUCCC----AAU-----------------------------------------------------------------------G----------CAGUGA-----
>1VQK 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAA
0.004
0.007

RFAM families found for your sequence with PDB structures with the resolution worse than 2.5 Å: RFAM families found for your sequence without PDB structures (number of occurances):
Valid HTML 4.01! Made with Django.