Home
Submit
All results

ModeRNA
Help
Tutorial
Contact

Genesilico Homepage

The results of your job 'wnv3u_A' are ready.


Structure after analysis:
[wnv3u_A.renumbered_chain.pdb]

Sequence of a given structure:

GGAGUCAGGCCAGAUUAAUGCUGCCACCGGAAGUUGAGUAGACGGUGCUG
CCUGCGGCUCAACCCCAGGAGGACUGGGUGACCAAAGCUGCGAGGUGAUC
CACGUAAGCCCUCAGAACCGUCUCGGAAGGAGGACCCCACGUGCUUUAGC
CUCAAGGCCCAGUGUCAGACCACACUCUAGUGUGCCACUCUGCGGAGAGU
GCAGUCUGCGAUAGUGCCCCAGGUGGACUGGGUUAACAAAGGCAAAACAU
CGCCCCACGCGGCCAUAACCCUGGCUAUGGUGUUAACCAGGGAGAAGGGA
CUAGAGGUUAGAGGAGACCCCGCGUCAAAAAGUGCACGGCCCAACUUGGC
UGAAGCUGUAAGCCAAGGGAAGGACUAGAGGUUAGAGGAGACCCCGUGCC
AAAAACACCAAAAGAAACAGCAUAUUGACACCUGGGAUAGACUAGGGGAU
CUUCUGCUCUGCACAACCAGCCACACGGCACAGUGCGCCGAUAUAGGUGG
CUGGUGGUGCGAGAACACAGGAUCU
Download: [.fasta file with the sequence]

Secondary structure of a given structure:

..((......(((.......))).(((((.............))))))).
..............((((.....)))).........((...(((((....
(((((..(.((((....(((...)))...))))..)..))))).....))
)))...)).....(......(((((....))))).((((((....)))))
))................((((.....))))...........(.......
.)....((((.((.....((((((.((......)).))))))......).
.....((((......))))).))))........((((((.((..(((((.
(.........).)))))....))......((((......)))))))))).
...............................((((......))))..(((
(((.((.(((((((.(((((((((.((((.......))))......))))
))))).)))).))).)).)))))).

Java Get Powered

Download: [.vienna file with the secondary structure]
Valid HTML 4.01! Made with Django.