Home
Submit
All results

ModeRNA
Help
Tutorial
Contact

Genesilico Homepage

The results of your job 'kaustav' are ready.


Provided sequence:
ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAGUUUCUGCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUUUUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAAAAAAAAAAAAAAA

Results for the structures of the resolution better than 2.5 Å:


Rfam Family PDB ID Alingment Identity Similarity .aln file .pdb file
RF00177 1FFK_0
>Target   ACUAGUGAUUUGUGGAGCCCUUUAA----GC-AUCCUCUAAACCAAUCCAUCA--------AGACUUGAAUCUU-GUUUGU-----AAUAAGGAUGAAGCUUCU---UUGUUGGCAAAAAUCCAUCCA-UGGUUCUUAAAACAAACA---------------------UGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAA-UAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCC--AACUUUAUGAUGUACUUCAAUU-CACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUG---------------------UUUCAGUUUCU--GCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUUUUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGU---------------UAAAA-----AAAAA------AAAAAA
>1FFK 0   UAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGA-UGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUU-UCCGAAU--------------GAGAAUCUCUA------------CAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUGAAAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUUGUUCGCCUAUUAAAGGAGGUCGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUU-GGUG--GCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACA------CGGGGUAAGAGC-UGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGG----UCCCGCGUAC----AA--G---ACGCGG----UCGAUAG---------------------------------------------------------ACUCGGGGU----GUGCGCG-UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.068
0.097
RF00177 1JJ2_0
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCA-----AGACUUGAAUCUU-GUUUGU----AAUAAGGAUGA--AGCUUCU----U---UGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACA---------------UGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCC----AACUUUAUGA----UGUACUUCAAUU-CACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUG---------------UU---UCAG---UUUCUGCAGAUGAGUAAGGUAGG---UAAAUGUUUGUGUCUG-UUUCCCUUUUUCAUGUG-UGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGU---------------UAAAA-----AAAAA------AAAAAA
>1JJ2 0   UAUGCCAGCUGG-----UGGA-UU-GCUC------------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUGAAAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUUGUUCGCCUAUUAAAGGAGGUCGUGAGCUGGGUUUAGACCGUCGUGAGACAGGU--CGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGU--UGGUGGCCACU-GGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAAC--C---CACUUGGAAAAGAGACACCGC---CGAGGUCCCG----CGUACAAGAC--------------GCGGUCGAUAG---ACUCGGGGU----GUGCGCG-UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.059
0.089
RF00177 1VQM_0
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCA-----AGACUUGAAUCUU-GUUUGU----AAUAAGGAUGA--AGCUUCU----U---UGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACA---------------UGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCC----AACUUUAUGA----UGUACUUCAAUU-CACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUG---------------UU---UCAG---UUUCUGCAGAUGAGUAAGGUAGG---UAAAUGUUUGUGUCUG-UUUCCCUUUUUCAUGUG-UGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGU---------------UAAAA-----AAAAA------AAAAAA
>1VQM 0   UAUGCCAGCUGG-----UGGA-UU-GCUC------------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGU--CGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGU--UGGUGGCCACU-GGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAAC--C---CACUUGGAAAAGAGACACCGC---CGAGGUCCCG----CGUACAAGAC--------------GCGGUCGAUAG---ACUCGGGGU----GUGCGCG-UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.058
0.089
RF00177 1VQL_0
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCA-----AGACUUGAAUCUU-GUUUGU----AAUAAGGAUGA--AGCUUCU----U---UGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACA---------------UGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCC----AACUUUAUGA----UGUACUUCAAUU-CACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUG---------------UU---UCAG---UUUCUGCAGAUGAGUAAGGUAGG---UAAAUGUUUGUGUCUG-UUUCCCUUUUUCAUGUG-UGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGU---------------UAAAA-----AAAAA------AAAAAA
>1VQL 0   UAUGCCAGCUGG-----UGGA-UU-GCUC------------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGU--CGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGU--UGGUGGCCACU-GGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAAC--C---CACUUGGAAAAGAGACACCGC---CGAGGUCCCG----CGUACAAGAC--------------GCGGUCGAUAG---ACUCGGGGU----GUGCGCG-UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.058
0.089
RF00177 1VQP_0
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCA-----AGACUUGAAUCUU-GUUUGU----AAUAAGGAUGA--AGCUUCU----U---UGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACA---------------UGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCC----AACUUUAUGA----UGUACUUCAAUU-CACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUG---------------UU---UCAG---UUUCUGCAGAUGAGUAAGGUAGG---UAAAUGUUUGUGUCUG-UUUCCCUUUUUCAUGUG-UGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGU---------------UAAAA-----AAAAA------AAAAAA
>1VQP 0   UAUGCCAGCUGG-----UGGA-UU-GCUC------------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGU--CGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGU--UGGUGGCCACU-GGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAAC--C---CACUUGGAAAAGAGACACCGC---CGAGGUCCCG----CGUACAAGAC--------------GCGGUCGAUAG---ACUCGGGGU----GUGCGCG-UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.058
0.089
RF00177 1VQK_0
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCA-----AGACUUGAAUCUU-GUUUGU----AAUAAGGAUGA--AGCUUCU----U---UGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACA---------------UGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCC----AACUUUAUGA----UGUACUUCAAUU-CACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUG---------------UU---UCAG---UUUCUGCAGAUGAGUAAGGUAGG---UAAAUGUUUGUGUCUG-UUUCCCUUUUUCAUGUG-UGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGU---------------UAAAA-----AAAAA------AAAAAA
>1VQK 0   UAUGCCAGCUGG-----UGGA-UU-GCUC------------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGU--CGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGU--UGGUGGCCACU-GGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAAC--C---CACUUGGAAAAGAGACACCGC---CGAGGUCCCG----CGUACAAGAC--------------GCGGUCGAUAG---ACUCGGGGU----GUGCGCG-UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.058
0.089
RF00177 1S72_0
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCA-----AGACUUGAAUCUU-GUUUGU----AAUAAGGAUGA--AGCUUCU----U---UGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACA---------------UGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCC----AACUUUAUGA----UGUACUUCAAUU-CACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUG---------------UU---UCAG---UUUCUGCAGAUGAGUAAGGUAGG---UAAAUGUUUGUGUCUG-UUUCCCUUUUUCAUGUG-UGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGU---------------UAAAA-----AAAAA------AAAAAA
>1S72 0   UAUGCCAGCUGG-----UGGA-UU-GCUC------------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGU--CGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGU--UGGUGGCCACU-GGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAAC--C---CACUUGGAAAAGAGACACCGC---CGAGGUCCCG----CGUACAAGAC--------------GCGGUCGAUAG---ACUCGGGGU----GUGCGCG-UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.058
0.089
RF00177 1VQ8_0
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCA-----AGACUUGAAUCUU-GUUUGU----AAUAAGGAUGA--AGCUUCU----U---UGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACA---------------UGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCC----AACUUUAUGA----UGUACUUCAAUU-CACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUG---------------UU---UCAG---UUUCUGCAGAUGAGUAAGGUAGG---UAAAUGUUUGUGUCUG-UUUCCCUUUUUCAUGUG-UGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGU---------------UAAAA-----AAAAA------AAAAAA
>1VQ8 0   UAUGCCAGCUGG-----UGGA-UU-GCUC------------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGU--CGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGU--UGGUGGCCACU-GGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAAC--C---CACUUGGAAAAGAGACACCGC---CGAGGUCCCG----CGUACAAGAC--------------GCGGUCGAUAG---ACUCGGGGU----GUGCGCG-UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.058
0.089
RF00177 1VQO_0
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCA-----AGACUUGAAUCUU-GUUUGU----AAUAAGGAUGA--AGCUUCU----U---UGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACA---------------UGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCC----AACUUUAUGA----UGUACUUCAAUU-CACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUG---------------UU---UCAG---UUUCUGCAGAUGAGUAAGGUAGG---UAAAUGUUUGUGUCUG-UUUCCCUUUUUCAUGUG-UGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGU---------------UAAAA-----AAAAA------AAAAAA
>1VQO 0   UAUGCCAGCUGG-----UGGA-UU-GCUC------------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGU--CGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGU--UGGUGGCCACU-GGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAAC--C---CACUUGGAAAAGAGACACCGC---CGAGGUCCCG----CGUACAAGAC--------------GCGGUCGAUAG---ACUCGGGGU----GUGCGCG-UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.058
0.089
RF00177 1VQ9_0
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCA-----AGACUUGAAUCUU-GUUUGU----AAUAAGGAUGA--AGCUUCU----U---UGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACA---------------UGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCC----AACUUUAUGA----UGUACUUCAAUU-CACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUG---------------UU---UCAG---UUUCUGCAGAUGAGUAAGGUAGG---UAAAUGUUUGUGUCUG-UUUCCCUUUUUCAUGUG-UGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGU---------------UAAAA-----AAAAA------AAAAAA
>1VQ9 0   UAUGCCAGCUGG-----UGGA-UU-GCUC------------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGU--CGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGU--UGGUGGCCACU-GGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAAC--C---CACUUGGAAAAGAGACACCGC---CGAGGUCCCG----CGUACAAGAC--------------GCGGUCGAUAG---ACUCGGGGU----GUGCGCG-UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.058
0.089
RF00177 1VQN_0
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCA-----AGACUUGAAUCUU-GUUUGU----AAUAAGGAUGA--AGCUUCU----U---UGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACA---------------UGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCC----AACUUUAUGA----UGUACUUCAAUU-CACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUG---------------UU---UCAG---UUUCUGCAGAUGAGUAAGGUAGG---UAAAUGUUUGUGUCUG-UUUCCCUUUUUCAUGUG-UGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGU---------------UAAAA-----AAAAA------AAAAAA
>1VQN 0   UAUGCCAGCUGG-----UGGA-UU-GCUC------------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGU--CGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGU--UGGUGGCCACU-GGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAAC--C---CACUUGGAAAAGAGACACCGC---CGAGGUCCCG----CGUACAAGAC--------------GCGGUCGAUAG---ACUCGGGGU----GUGCGCG-UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.058
0.089
RF00177 3CC2_0
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCA--------------------AGACUUGAAUCUU-GUUUGU-----AA-UAAGGAUGA---AGCUUCU----U---------------------UGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACA-----UGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCC----AACUUUAUGA----UGUACUUCAAUU-CACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUG---------------UU---UCAG---UUUCUGCAGAUGAGUAAGGUAGG---UAAAUGUUUGUGUCUG-UUUCCCUUUUUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGU---------------UAAAA-----AAAAA------AAAAAA
>3CC2 0   UAUGCCAGCUGG-----UGGA-UU-GCUCGG-CUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCUGUGGGGAGCCGCACGGAGGCGAAGAACCACAGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUG-----------AGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAACGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUUCACGAAGUCUCUUGGAAUAGAGCGUGAUACAGGGUGACAACCCCGUACUGAAGACCAGUACGCUGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUUGACGAAUGACCGAGACGCGAGUCUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGUAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCUGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGCAGGGGCGAGAGCUCCUGUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCUCACCGCAACUCGACUGAGACGAAAUGGGAAACAGGUUAAUAUUCCUGUGCCAUCAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCCGGGCAUCGCCCGGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUGAUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGUCAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUGACUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGU--CGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGU--UGGUGGCCACU-GGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAAC--C---CACUUGGAAAAGAGACAC-C-------------------GCCGAGGUCCCGCGUACAAGACGCGGUCGAUAG---ACUCGGGGU----GUGCGCG-UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.057
0.09
RF00177 1YHQ_0
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCA--------------------AGACUUGAAUCUU-GUUUGU-----AA-UAAGGAUGA---AGCUUCU----U---------------------UGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACA-----UGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCC----AACUUUAUGA----UGUACUUCAAUU-CACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUG---------------UU---UCAG---UUUCUGCAGAUGAGUAAGGUAGG---UAAAUGUUUGUGUCUG-UUUCCCUUUUUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGU---------------UAAAA-----AAAAA------AAAAAA
>1YHQ 0   UAUGCCAGCUGG-----UGGA-UU-GCUCGG-CUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCUGUGGGGAGCCGCACGGAGGCGAAGAACCACAGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUG-----------AGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAACGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUUCACGAAGUCUCUUGGAAUAGAGCGUGAUACAGGGUGACAACCCCGUACUGAAGACCAGUACGCUGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUUGACGAAUGACCGAGACGCGAGUCUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGUAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCUGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGCAGGGGCGAGAGCUCCUGUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCUCACCGCAACUCGACUGAGACGAAAUGGGAAACAGGUUAAUAUUCCUGUGCCAUCAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCCGGGCAUCGCCCGGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUGAUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCAAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGUCAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUGACUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGU--CGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGU--UGGUGGCCACU-GGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAAC--C---CACUUGGAAAAGAGACAC-C-------------------GCCGAGGUCCCGCGUACAAGACGCGGUCGAUAG---ACUCGGGGU----GUGCGCG-UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.057
0.09
RF00028 1HR2_B
>Target   ACUA-GUGAUU---------UGUGGAGCCC-UUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAA-----------------------UCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAGUUUCUGCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUUUUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAA-AAAAAAAAAAA--AA
>1HR2 B   GGAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUA--------CCAAGU-----------------------------------------------------CUCAGGGGAAACUUUGAGAUGGCCUUGCAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACACGCAGCCAAGUCCUAAGUCAACAGAU-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CUUCUG---UUGA---UAUGG-AUGC----AGUUC
0.053
0.077
RF00028 1HR2_A
>Target   ACUA-GUGAUU----------------UGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAA-----------------------UCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAGUUUCUGCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUUUUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAA-AAAAAAAAAAA--AA
>1HR2 A   GAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCA------------AGUCU--------------------------------------------------------CAGGGGAAACUUUGAGAUGGCCUUGCAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACACGCAGCCAAGUCCUAAGUCAACAGAU-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CUUCUG---UUGA---UAUGG-AUGC----AGUUC
0.052
0.073
RF00001 3CC2_9
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAGUUUCUGCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUU--UUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAAA-AAAAAAAAAAAA
>3CC2 9   UUAGGCGGCCA-CAGC-GGUGGGGU-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCCU----CCCGUACCCA------UCCCGAACACGGAAGAUAAGCCCACCA------------------------GCGUUCCAGGGA--GUACU-----GGAGUGCGCGA---GCCUCUG-------------GGAAAUCC----------------------------GGUUCGCCGCC-ACC
0.049
0.076
RF00001 1JJ2_9
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAGUUUCUGCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUU--UUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAAA-AAAAAAAAAAAA
>1JJ2 9   UUAGGCGGCCA-CAGC-GGUGGGGU-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCCU----CCCGUACCCA------UCCCGAACACGGAAGAUAAGCCCACCA------------------------GCGUUCCGGGGA--GUACU-----GGAGUGCGCGA---GCCUCUG-------------GGAAACCC----------------------------GGUUCGCCGCC-ACC
0.049
0.076
RF00001 1VQM_9
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAGUUUCUGCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUU--UUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAAA-AAAAAAAAAAAA
>1VQM 9   UUAGGCGGCCA-CAGC-GGUGGGGU-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCCU----CCCGUACCCA------UCCCGAACACGGAAGAUAAGCCCACCA------------------------GCGUUCCGGGGA--GUACU-----GGAGUGCGCGA---GCCUCUG-------------GGAAACCC----------------------------GGUUCGCCGCC-ACC
0.049
0.076
RF00001 1VQK_9
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAGUUUCUGCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUU--UUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAAA-AAAAAAAAAAAA
>1VQK 9   UUAGGCGGCCA-CAGC-GGUGGGGU-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCCU----CCCGUACCCA------UCCCGAACACGGAAGAUAAGCCCACCA------------------------GCGUUCCGGGGA--GUACU-----GGAGUGCGCGA---GCCUCUG-------------GGAAACCC----------------------------GGUUCGCCGCC-ACC
0.049
0.076
RF00001 1VQN_9
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAGUUUCUGCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUU--UUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAAA-AAAAAAAAAAAA
>1VQN 9   UUAGGCGGCCA-CAGC-GGUGGGGU-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCCU----CCCGUACCCA------UCCCGAACACGGAAGAUAAGCCCACCA------------------------GCGUUCCGGGGA--GUACU-----GGAGUGCGCGA---GCCUCUG-------------GGAAACCC----------------------------GGUUCGCCGCC-ACC
0.049
0.076
RF00001 1VQ9_9
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAGUUUCUGCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUU--UUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAAA-AAAAAAAAAAAA
>1VQ9 9   UUAGGCGGCCA-CAGC-GGUGGGGU-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCCU----CCCGUACCCA------UCCCGAACACGGAAGAUAAGCCCACCA------------------------GCGUUCCGGGGA--GUACU-----GGAGUGCGCGA---GCCUCUG-------------GGAAACCC----------------------------GGUUCGCCGCC-ACC
0.049
0.076
RF00001 1VQO_9
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAGUUUCUGCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUU--UUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAAA-AAAAAAAAAAAA
>1VQO 9   UUAGGCGGCCA-CAGC-GGUGGGGU-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCCU----CCCGUACCCA------UCCCGAACACGGAAGAUAAGCCCACCA------------------------GCGUUCCGGGGA--GUACU-----GGAGUGCGCGA---GCCUCUG-------------GGAAACCC----------------------------GGUUCGCCGCC-ACC
0.049
0.076
RF00001 1VQP_9
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAGUUUCUGCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUU--UUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAAA-AAAAAAAAAAAA
>1VQP 9   UUAGGCGGCCA-CAGC-GGUGGGGU-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCCU----CCCGUACCCA------UCCCGAACACGGAAGAUAAGCCCACCA------------------------GCGUUCCGGGGA--GUACU-----GGAGUGCGCGA---GCCUCUG-------------GGAAACCC----------------------------GGUUCGCCGCC-ACC
0.049
0.076
RF00001 1YHQ_9
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAGUUUCUGCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUU--UUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAAA-AAAAAAAAAAAA
>1YHQ 9   UUAGGCGGCCA-CAGC-GGUGGGGU-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCCU----CCCGUACCCA------UCCCGAACACGGAAGAUAAGCCCACCA------------------------GCGUUCCAGGGA--GUACU-----GGAGUGCGCGA---GCCUCUG-------------GGAAAUCC----------------------------GGUUCGCCGCC-ACC
0.049
0.076
RF00001 1S72_9
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAGUUUCUGCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUU--UUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAAA-AAAAAAAAAAAA
>1S72 9   UUAGGCGGCCA-CAGC-GGUGGGGU-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCCU----CCCGUACCCA------UCCCGAACACGGAAGAUAAGCCCACCA------------------------GCGUUCCGGGGA--GUACU-----GGAGUGCGCGA---GCCUCUG-------------GGAAACCC----------------------------GGUUCGCCGCC-ACC
0.049
0.076
RF00001 1VQL_9
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAGUUUCUGCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUU--UUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAAA-AAAAAAAAAAAA
>1VQL 9   UUAGGCGGCCA-CAGC-GGUGGGGU-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCCU----CCCGUACCCA------UCCCGAACACGGAAGAUAAGCCCACCA------------------------GCGUUCCGGGGA--GUACU-----GGAGUGCGCGA---GCCUCUG-------------GGAAACCC----------------------------GGUUCGCCGCC-ACC
0.049
0.076
RF00001 1FFK_9
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAGUUUCUGCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUU--UUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAAA-AAAAAAAAAAAA
>1FFK 9   UUAGGCGGCCA-CAGC-GGUGGGGU-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCCU----CCCGUACCCA------UCCCGAACACGGAAGAUAAGCCCACCA------------------------GCGUUCCGGGGA--GUACU-----GGAGUGCGCGA---GCCUCUG-------------GGAAACCC----------------------------GGUUCGCCGCC-ACC
0.049
0.076
RF00001 1VQ8_9
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAGUUUCUGCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUU--UUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAAA-AAAAAAAAAAAA
>1VQ8 9   UUAGGCGGCCA-CAGC-GGUGGGGU-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UGCCU----CCCGUACCCA------UCCCGAACACGGAAGAUAAGCCCACCA------------------------GCGUUCCGGGGA--GUACU-----GGAGUGCGCGA---GCCUCUG-------------GGAAACCC----------------------------GGUUCGCCGCC-ACC
0.049
0.076
RF00028 2R8S_R
>Target   ACUA-GUGAUU---------UGUGGAGCCC-UUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAA-----------------------UCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCACUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAGUUUCUGCAGAUGAGUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUUUUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAA-----AAAAA--AAAAAA-----AA
>2R8S R   GGAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUA--------CCAAGU-----------------------------------------------------CUCAGGGGAAACUUUGAGAUGGCCUUGCAAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACACGCAGCCAAGUCCUAAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUCA
0.042
0.065
RF00017 1LNG_B
>Target   ACUAGUGAUUUGUGGAGCCCUUUAAGCAUCCUCUAAACCAAUCCAUCAAGACUUGAAUCUUGUUUGUAAUAAGGAUGAAGCUUCUUUGUUGGCAAAAAUCCAUCCAUGGUUCUUAAAACAAACAUGGAGAGAAGUGUGAGAGGGUAUUAAACAAAAACCCUACACACUCUCCCACCAUUUUCCUAAACAGUUUGCUUUGUGCUUUAGCUUUUGGCUUCUCAUAUCACAAAGGGAUUAUGCUUUUUUCUGAGUAGCAGAAGCAAAUAAUUAAGCAUUUUUCUCCAAAGGAUCAGAAGCUUUUGUUAUAGCAUGGCAAACCGGCAAGUCACAAAAAGGCAAUGGAUUCCUUUUUGGAGUCUUAAUGGCUAUGUAUCAAUCACUCUAUCUAUGUAGCACUGACACUUUAGAUUGAAGGCGCGUCCCGUGCCUGUGUUUGUGCUUCGUAGAUUGUUAUAGUUAUUUUCUUGCAGUAGAAUGUAAUAAUAAACAUAAAGAUGGUGUUGUCUUCCUUUGAGAAAUUGCCAACUUUAUGAUGUACUUCAAUUCA-CUCAAUUUGCAGCUGACUAGAGUCUGUUCUUGUUUCAG-UUUCUGCAGAUGA--GUAAGGUAGGUAAAUGUUUGUGUCUGUUUCCCUUUUUCAUGUGUGUAUGUAUGCUUCUUGUGUUAUGGACUUAUGGCCUUACAUUCAAUAAAAGUUUUCAUCUGAUGUUUCAUUGUUGAAGUUAAAAAAAAAAAAAAA
>1LNG B   -----------------------------------------------------------------------------------------------------------------------U-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGGCG-----GUG-----G---------------GG-GAGCAU----------------------C----------------------------------U---------CC-------------UGUAGGGGA-----------GAUG--------UA---ACCCCCUUUA--CCUGCCGAACCCCGCCAGGCCCGGAAGGGAGCA------ACGGU-AGGCAGGAC--------------G------------------------------------U--------------C--------------------------
0.037
0.05

RFAM families found for your sequence with PDB structures with the resolution worse than 2.5 Å: RFAM families found for your sequence without PDB structures (number of occurances):
Valid HTML 4.01! Made with Django.