Home
Submit
All results

ModeRNA
Help
Tutorial
Contact

Genesilico Homepage

The results of your job 'w_4th' are ready.


Structure after analysis:
[w_4th.renumbered_chain.pdb]

Sequence of a given structure:

GGAGUCAGGCCAGAUUAAUGCUGCCACCGGAAGUUGAGUAGACGGUGCUG
CCUGCGGCUCAACCCCAGGAGGACUGGGUGACCAAAGCUGCGAGGUGAUC
CACGUAAGCCCUCAGAACCGUCUCGGAAGGAGGACCCCACGUGCUUUAGC
CUCAAGGCCCAGUGUCAGACCACACUCUAGUGUGCCACUCUGCGGAGAGU
GCAGUCUGCGAUAGUGCCCCAGGUGGACUGGGUUAACAAAGGCAAAACAU
CGCCCCACGCGGCCAUAACCCUGGCUAUGGUGUUAACCAGGGAGAAGGGA
CUAGAGGUUAGAGGAGACCCCGCGUCAAAAAGUGCACGGCCCAACUUGGC
UGAAGCUGUAAGCCAAGGGAAGGACUAGAGGUUAGAGGAGACCCCGUGCC
AAAAACACCAAAAGAAACAG_CAUAUUGACACCUGGGAUAGACUAGGGGA
UCUUCUGCUCUGCACAACCAGCCACACGGCACAGUGCGCCGAUAUAGGUG
GCUGGUGGUGCGAGAACACAGGAUCU
Download: [.fasta file with the sequence]
Valid HTML 4.01! Made with Django.