Home
Submit
All results

ModeRNA
Help
Tutorial
Contact

Genesilico Homepage

The results of your job '1h4s' are ready.


Structure after analysis:
[1h4s.pdb]

Sequence of a given structure:

GGAGUAGCGCAGCCCGGUAGCGCACCUCGUUCGGGACGAGGGGGGCGCUG
GTPCAGAUCCAGUCUCC_._.
Download: [.fasta file with the sequence]
Valid HTML 4.01! Made with Django.