Home
Submit
All results

ModeRNA
Help
Tutorial
Contact

Genesilico Homepage

The results of your job 'NATIVE_TRNA_LEU' are ready.


Structure after analysis:
[NATIVE_TRNA_LEU.pdb]

Sequence of a given structure:

GUUAAGAUGGCAGAC_CCGGUAAUCGCAUAAAACUUAAACUUUACAG_UC
AGAGGUUCAA_UCCUCUUCUUAACACCA
Download: [.fasta file with the sequence]

Geometry of the structure:

        Unusual bond lengths:
- Residue 916 (X:C5',X:C4'): 1.85
- Residue 946 (X:C5',X:C4'): 1.82
- Residue 959 (X:C5',X:C4'): 1.87
- Residue 912 (X[A]:C1',X[A]:N9): 1.37
- Residue 920A (X[A]:C1',X[A]:N9): 1.37
- Residue 928 (X[A]:C1',X[A]:N9): 1.37
- Residue 935 (X[A]:C1',X[A]:N9): 1.37
- Residue 944 (X[A]:C1',X[A]:N9): 1.38
- Residue 949 (X[A]:C1',X[A]:N9): 1.38
- Residue 970 (X[A]:C1',X[A]:N9): 1.38
- Residue 971 (X[A]:C1',X[A]:N9): 1.38
- Residues 919 --- 918 (X:O3',X+1:P): 1.07

Unusual bond angles:
- Residues 915 --- 916 (X:C3',X:O3',X+1:P): 28.92
- Residues 919 --- 920 (X:C3',X:O3',X+1:P): 86.65
- Residues 921 --- 922 (X:C3',X:O3',X+1:P): 150.87
- Residues 946 --- 945 (X:C3',X:O3',X+1:P): 66.54
- Residues 962 --- 961 (X:C3',X:O3',X+1:P): 144.58
- Residue 922 (X:P,X:O5',X:C5'): 94.38
- Residue 949 (X:P,X:O5',X:C5'): 95.16
- Residue 916 (X:O5',X:C5',X:C4'): 151.15
- Residue 946 (X:O5',X:C5',X:C4'): 133.25
- Residue 959 (X:O5',X:C5',X:C4'): 143.79
- Residue 916 (X:C5',X:C4',X:C3'): 153.30
- Residue 922 (X:C5',X:C4',X:C3'): 90.84
- Residue 946 (X:C5',X:C4',X:O4'): 79.42
- Residue 959 (X:C5',X:C4',X:O4'): 83.71
- Residues 915 --- 916 (X:O3',X+1:P,X+1:O5'): 126.92

Unusual dihedral angles:
- Residues 935 --- 934 (X:O3',X+1:P,X+1:O5',X+1:C5'): 337.67
- Residues 901A --- 902 (X:C4',X:C3',X:O3',X+1:P): 89.84
- Residues 915 --- 916 (X:C4',X:C3',X:O3',X+1:P): 134.31
- Residues 946 --- 945 (X:C4',X:C3',X:O3',X+1:P): 134.68
- Residues 958 --- 959 (X:C4',X:C3',X:O3',X+1:P): 148.67
- Residue 902 (X:O5',X:C5',X:C4',X:C3'): 225.29
- Residues 937 --- 936 (X:C3',X:O3',X+1:P,X+1:O5'): 15.05
- Residues 962 --- 961 (X:C3',X:O3',X+1:P,X+1:O5'): 354.23
- Residue 916 (X:C5',X:C4',X:C3',X:O3'): 38.29
- Residue 946 (X:C5',X:C4',X:C3',X:O3'): 119.05
- Residue 959 (X:C5',X:C4',X:C3',X:O3'): 179.21


Clashing residues:
- Residues 958 (A) --- 959 (U) 
- Residues 915 (C) --- 916 (C) 
- Residues 918 (G) --- 919 (G) 
- Residues 945 (G) --- 946 (U) 

    
Valid HTML 4.01! Made with Django.