Modomics - A Database of RNA Modifications

General Data

RNA Type tRNA
SOTerm None
Original Source LC530726.1
Secondary Structure (((((((..(((((..))))).(((((.......)))))....(((((.....))))))))))))....
Sequence (UNICHARACTER ENCODING) GGUAAAAUKLCUGAGUGAAGCAPPGGACUQUA*APCUAAAGA?AGGGGUUAGGCCUCUUUUUACCACCA
Sequence (SHORT NAMES ENCODING) GGUAAAAUpm1Gpm2GCUGAGUGAAGCApYpYGGACUpQUApms2i6AApYCUAAAGApm5CAGGGGUUAGGCCUCUUUUUACCACCA
Sequence (MODOMICS CODE ENCODING) GGUAAAAU2000001551G2000002551GCUGAGUGAAGCA2000009551U2000009551UGGACU2000042551GUA2002161551AA2000009551UCUAAAGA2000005551CAGGGGUUAGGCCUCUUUUUACCACCA
Consensus Secondary Structure .(((((((..((((......[....)))).(((((.......)))))........................(((((..]....))))))))))))....
Alignment with Modification -GGUAAAAUKLCUGAGU-------GAAGCAPPGGACUQUA*APCUAAAGA?--------------------AGGGGUUAGG--CCUCUUUUUACCACCA

Score Table

Table containing the score explanation. Score identify the level of experimental reliability and evidence so as exaplained in the 2023 release manuscript. Class 1 should be considered as highlyrelevant. Class 2 evidences are considered as Solid, namely large errors are unlikely and minor errors should not undermine the meaning of data. Class 3 is considered as speculative and errors are expected. Class 4 is considered as questionable. Class 5 evidence means that verification and data are still to be collected. Class 6 data cannot be estimated.
Method Classification Score
Multiple direct experimental evidence 1
Direct experimental evidence 2
Inferred based on indirect experimental evidence 3
Predicted computationally 4
Evidence not yet annotated (Unknown) 5
Irrelevant 6

RNA-2D Representation

RNA Secondary Structure

RNA Consensus Secondary Structure

Modification Positions

Table containing the original modifications present in the MODOMICS sequences. Edit locations not originally present in the RNA sequences are marked by their source. Their scores are in third row.

Position in the alignment 9 10 27 28 34 37 39 45B
Position in the sequence 9 10 23 24 30 33 35 43
Modification positions m1G m2G Y Y Q ms2i6A Y m5C
Source 32859890 32859890 32859890 32859890 32859890 32859890 32859890 32859890

Modification Annotation

Table containing the data present in the literature relating to the modification positions present in the RNA sequences. Some of the modified residuals may differ from the modifications originally present in MODOMICS. It follows the same format as the previous table. The table reports the scores that have been associated to the modified nucleotides so to have an estimation of the reliability of their presence.
Position in the alignment 9 10 27 28 34 37 39 45B
Position in the sequence 9 10 23 24 30 33 35 43
Source: 32859890 m1G m2G Y Y Q ms2i6A Y m5C
Level of Experimental Reliability 2 2 2 2 2 2 2 2
Level of Experimental Evidence 2 2 2 2 2 2 2 2