CompaRNA - on-line benchmarks of RNA structure prediction methods

Laboratory of Bioinformatics and Protein Engeneering

Home

Methods

Datasets

Rankings

RNA 2D Atlas

Help

FAQ

Contact us

RSS feeds

Twitter

RNA Secondary Structure Atlas - RNASTRAND - PDB_00377

RNA: PDB_00377
Rfam family: -

			GGGCGCCGGUACGCAAGUACGACGGUACGCUCC
Reference structure (ext)		[ sec struct ]	((((((((((((....))))..)))..))))).
Afold	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))).))
Alterna	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
CRWrnafold	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..))))..)))).
CentroidFold	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
CentroidHomfold‑LAST	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
ContextFold	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..))))..)))).
Contrafold	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
Cylofold	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..))))..)))).
DotKnot	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
Fold	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
HotKnots	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
IPknot	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
MCFold (ext)	[ FASTA input ]	[ sec struct ]	(((((((((((((..)))))..)))..))))).
MaxExpect	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
McQFold	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
Pknots	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..))))..)))).
PknotsRG	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
ProbKnot	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
RDfolder	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
RNASLOpt	[ FASTA input ]	[ sec struct ]	....((((((((....))))..)))).......
RNAfold	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
RNAshapes	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
RNAsubopt	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
RNAwolf (ext)	[ FASTA input ]	[ sec struct ]	(((((((((((((..)))))..)))..))))).
Sfold	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
UNAFold	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..)))..))))).
Vsfold4	[ FASTA input ]	[ sec struct ]	((((((((((((....))))..))))..)))).
Vsfold5	[ FASTA input ]	[ sec struct ]	((((.(((.(((....)))...)))...)))).

^top