CompaRNA - on-line benchmarks of RNA structure prediction methods

Laboratory of Bioinformatics and Protein Engeneering

Home

Methods

Datasets

Rankings

RNA 2D Atlas

Help

FAQ

Contact us

RSS feeds

Twitter

RNA Secondary Structure Atlas - RNASTRAND - mir-TAR

RNA: PDB_00012

			GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
Reference structure (ext)		[ sec struct ]	..(((....((((......)))).)))..
Afold	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
Alterna	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
CMfinder(seed)	[ FASTA input ]	[ sec struct ]	.(((((...((((......))))))))).
CMfinder(20)	[ FASTA input ]	[ sec struct ]	.(((((...((((......))))))))).
CRWrnafold	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
Carnac(seed)	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
Carnac(20)	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
CentroidAlifold(seed)	[ FASTA input ]	[ sec struct ]	.(((((...((((......))))))))).
CentroidAlifold(20)	[ FASTA input ]	[ sec struct ]	.(((((...((((......))))))))).
CentroidFold	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
CentroidHomfold‑LAST	[ FASTA input ]	[ sec struct ]	..((((...((((......))))))))..
ContextFold	[ FASTA input ]	[ sec struct ]	(((((....((((......)))).)))))
Contrafold	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
Cylofold	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
DAFS(seed)	[ FASTA input ]	[ sec struct ]	.(.(((...((((......))))))).).
DAFS(20)	[ FASTA input ]	[ sec struct ]	.(((((...((((......))))))))).
DotKnot	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
Fold	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
HotKnots	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
IPknot	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
MCFold (ext)	[ FASTA input ]	[ sec struct ]	((((((...(((((...).))))))))))
MXScarna(seed)	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
MXScarna(20)	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
Mastr(seed)	[ FASTA input ]	[ sec struct ]	.............................
Mastr(20)	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
MaxExpect	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
McQFold	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
Multilign(seed)	[ FASTA input ]	[ sec struct ]	.............................
Multilign(20)	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
Murlet(seed)	[ FASTA input ]	[ sec struct ]	..........(((......))).......
Murlet(20)	[ FASTA input ]	[ sec struct ]	..((((...((((......))))))))..
NanoFolder	[ FASTA input ]	[ sec struct ]	.............................
PETfold_2.0(seed)	[ FASTA input ]	[ sec struct ]	.(((((...((((......))))))))).
PETfold_2.0(20)	[ FASTA input ]	[ sec struct ]	.(((((...((((......))))))))).
PETfold_pre2.0(seed)	[ FASTA input ]	[ sec struct ]	.(((((...((((......))))))))).
PETfold_pre2.0(20)	[ FASTA input ]	[ sec struct ]	.(((((...((((......))))))))).
PPfold(seed)	[ FASTA input ]	[ sec struct ]	.............................
PPfold(20)	[ FASTA input ]	[ sec struct ]	.(((((...((((......))))))))).
Pknots	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
PknotsRG	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
ProbKnot	[ FASTA input ]	[ sec struct ]	((((((...((((.(...)))))))))))
RDfolder	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
RNASLOpt	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
RNASampler(seed)	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
RNASampler(20)	[ FASTA input ]	[ sec struct ]	.(((((...((((......))))))))).
RNAalifold(seed)	[ FASTA input ]	[ sec struct ]	..........(((......))).......
RNAalifold(20)	[ FASTA input ]	[ sec struct ]	.(((((...((((......))))))))).
RNAfold	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
RNAshapes	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
RNAsubopt	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
RNAwolf (ext)	[ FASTA input ]	[ sec struct ]	(((((.....(((......)))..)))))
RSpredict(seed)	[ FASTA input ]	[ sec struct ]	.((((....((((......)))).)))).
RSpredict(20)	[ FASTA input ]	[ sec struct ]	.(((((...((((......))))))))).
Sfold	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
TurboFold(seed)	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
TurboFold(20)	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
UNAFold	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
Vsfold4	[ FASTA input ]	[ sec struct ]	((((((...((((......))))))))))
Vsfold5	[ FASTA input ]	[ sec struct ]	(((((....((((......)))).)))))

^top

RNA: PDB_00553

			GGCCAGAUCUGAGCCUGGGAGCUCUCUGGCC
Reference structure (ext)		[ sec struct ]	(((((((...((((......)))))))))))
Afold	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
Alterna	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
CMfinder(seed)	[ FASTA input ]	[ sec struct ]	...............................
CMfinder(20)	[ FASTA input ]	[ sec struct ]	..(((((...((((......)))))))))..
CRWrnafold	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
Carnac(seed)	[ FASTA input ]	[ sec struct ]	(((((((.................)))))))
Carnac(20)	[ FASTA input ]	[ sec struct ]	...............................
CentroidAlifold(seed)	[ FASTA input ]	[ sec struct ]	.((((((...((((......)))))))))).
CentroidAlifold(20)	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
CentroidFold	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
CentroidHomfold‑LAST	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
ContextFold	[ FASTA input ]	[ sec struct ]	((((((....((((......)))).))))))
Contrafold	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
Cylofold	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
DAFS(seed)	[ FASTA input ]	[ sec struct ]	.((((((...((((......)))))))))).
DAFS(20)	[ FASTA input ]	[ sec struct ]	.((((((...((((......)))))))))).
DotKnot	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
Fold	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
HotKnots	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
IPknot	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
MCFold (ext)	[ FASTA input ]	[ sec struct ]	(((((((...(((((...).)))))))))))
MXScarna(seed)	[ FASTA input ]	[ sec struct ]	..(((((...((((......)))))))))..
MXScarna(20)	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
Mastr(seed)	[ FASTA input ]	[ sec struct ]	...............................
Mastr(20)	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
MaxExpect	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
McQFold	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
Multilign(seed)	[ FASTA input ]	[ sec struct ]	...............................
Multilign(20)	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
Murlet(seed)	[ FASTA input ]	[ sec struct ]	(..........(((......)))......).
Murlet(20)	[ FASTA input ]	[ sec struct ]	(.........((((......)))).....).
NanoFolder	[ FASTA input ]	[ sec struct ]	...............................
PETfold_2.0(seed)	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
PETfold_2.0(20)	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
PETfold_pre2.0(seed)	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
PETfold_pre2.0(20)	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
PPfold(seed)	[ FASTA input ]	[ sec struct ]	...............................
PPfold(20)	[ FASTA input ]	[ sec struct ]	..........((((......)))).......
Pknots	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
PknotsRG	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
ProbKnot	[ FASTA input ]	[ sec struct ]	(((((((...((((.(...))))))))))))
RDfolder	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
RNASLOpt	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
RNASampler(seed)	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
RNASampler(20)	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
RNAalifold(seed)	[ FASTA input ]	[ sec struct ]	...........(((......)))........
RNAalifold(20)	[ FASTA input ]	[ sec struct ]	.(........((((......))))......)
RNAfold	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
RNAshapes	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
RNAsubopt	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
RNAwolf (ext)	[ FASTA input ]	[ sec struct ]	((((((.....(((......)))..))))))
RSpredict(seed)	[ FASTA input ]	[ sec struct ]	.(((((....((((......)))).))))).
RSpredict(20)	[ FASTA input ]	[ sec struct ]	.(((((....((((......)))).))))).
Sfold	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
TurboFold(seed)	[ FASTA input ]	[ sec struct ]	...............................
TurboFold(20)	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
UNAFold	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
Vsfold4	[ FASTA input ]	[ sec struct ]	(((((((...((((......)))))))))))
Vsfold5	[ FASTA input ]	[ sec struct ]	((((((....((((......)))).))))))

^top