| Experiment Name | Rloop bottom |
|---|---|
| Type | DNA |
| Subtype | ssDNA |
| Low Wave Length | 170 |
| High Wave Length | 321 |
| Interval | 1 |
| Dwell Time | 1.2 |
| Concentration | 1.0(mM) |
| Cell id | CaF2 |
| Units | mdeg,delta_epsilon |
| Temperature | 15.0 |
| Zeroed Between | 310-315 |
Sequence
   5'GCTGGATCCATACCCACCCACCCACCCTGAATTCGGCG3'
Cite
Pictures and data taken from NACDDB must be cited in your work following the instructions given in the Frequently Asked Questions Section (FAQ)