| Experiment Name | d_T10G4A10_parallel |
|---|---|
| Type | DNA |
| Subtype | ssDNA |
| Low Wave Length | 201 |
| High Wave Length | 319 |
| Interval | 1(nm) |
| Dwell Time | 0(s) |
| Concentration | 0.1 M NaCl, 0.01 M Na3PO4 buffer, 0.1 mM EDTA |
| Temperature | 23(°C) |
Sequence
   5'TTTTTTTTTTGGGGAAAAAAAAAA3'
Cite
Pictures and data taken from NACDDB must be cited in your work following the instructions given in the Frequently Asked Questions Section (FAQ)