| Experiment Name | pseudoknot_experiment.gen |
|---|---|
| Type | RNA |
| Subtype | ssRNA |
| Low Wave Length | 170 |
| High Wave Length | 321 |
| Interval | 1(nm) |
| Dwell Time | 9(s) |
| Concentration | 0(mM) |
| Cell id | CaF2 |
| Temperature | 0(°C) |
| Zeroed Between | 320-0 |
Sequence
   5'GGGCUGUUUUUCUCGCUGACUUUCAGCCCCAAACAAAAAAGUCAGCA3'
Cite
Pictures and data taken from NACDDB must be cited in your work following the instructions given in the Frequently Asked Questions Section (FAQ)