Home
Submit
All results

ModeRNA
Help
Tutorial
Contact

Genesilico Homepage

The results of your job '16s' are ready.


Provided sequence:
AUCCAUGGAGAGUUUGAUCCUGGCUCAGGACGAACGCUGGCGGCAUGCUUAACACAUGCAAGUCGAACGAGCAAAGCAAUUUGUGUAGUGGCGAACGGGUGCGUAACGCGUAAGAACCUACCUAUCGGAGGGGGAUAACAUUGGGAAACUGUUGCUAAUACCCCAUACAGCUGAGGAGUGAAAGGUGAAAAACCGCCGAUAGAGGGGCUUGCGUCUGAUUAGCUAGUUGGUGGGGGUAACGGCCUCCCAAGGCCACGAGCAGUAGCUGGUCUGAGAGGAUGAUCAGCCACACUGGGACUGAGACACGGCCCAGACUCCUACGGGAGGCAGCAGUGAGGAAUUUUUCGCAAUGGGCGCAAGCGACGGAGCAAUGCCGCGUGCAGGAAGAAGGCCUGUGGGUCGUAAACUGCUUUUCUCAGAGAAGAAGUUCUGACGGUAUCUGAGGAAUAAGCACCGGCUAACUCUGUGCCAGCAGCCGCGGUAAUACAGAGGGUGCAAGCGUUGUCCGCAAUGAUUGGGCGUAAAGCGUCUGUAGGUGGCUCGUAAAGUCUAAUGUCAAAUACCAGGGCUCAACCUUGGACCGGCAUUGGAGUACUCACGAGCUUGAGUACGGUAGGGGCAGAGGGAAUUCCAUGUGGAGCGGUGAAAUGCGUAGAGAUAUGGAGGAACACCAGUGGCGAAGGCGCUCUGCUGGGCCGAAACUGACACUGAGAGACGAAAGCUGGGGGAGCGAAUAGGAUUAGAUACCCUAGUAGUCCCAGCCGUAAACUAUGGAGACUAAGUGCUGCCGCAAGCAGUGCUGUAGCUAACGCGUUAAGUCUCCCGCCUGGGGAGUAUGCUCGCAAGAGUGAAACUCAAAGGAAUUGACGGGACCGCACAAGCGGUGGAUUAUGUGGAUUAAUUCGAUACAACGCGAAGAACCUUACCAGGGUUUGACAUGUCAAGAACCUCUCAGAAAUGGGAGGGUGCCCUAACGGACUUGAACACAGGUGGUGCAUGGCUGUCGUCAGCUCGUGCUGUGAAGUGUAUAGUUAAGUCUCAUAACGAGCGCAACCCUCGUCUUUAGUUGCCAUUUGGUUCUCUAAAGAGACUGCCAGUGUAAGCUGGAGGAAGGUGAGGAUGACGUCAAGUCAGCAUGCCCCUUACAUCCUGGGCUUCACACGUAAUACAAUGGUUGGGACAAUCAGAAGCGACUCGUGAGAGCUAGCGGCUCUGUUAAACCCAACCUCAGUUCGGAUUGUAGGCUGCAACUCGCCUACAUGAAGCCGGAAUCGCUAGUAAUCGCCAGUCAGCUAUAUGGCGGUGAAUACGUUCCCGGGUCUUGUACACACCGCCCGUCACACCAUGGAAGCUGGUUCUGCUCCAAGUCGUUACCCUAACCUUCGGGAGGGGGGCGCCUAAAGCAGGGCUAGUGACUAGGGUGAAGUCGUAACAAGGUAGGGCUACUGGAAGGUGGCCCUGGCUCACCUCCUUC

Results for the structures of the resolution better than 2.5 Å:


Rfam Family PDB ID Alingment Identity Similarity .aln file .pdb file
RF00177 3CC2_0
>Target   AUCCAUGGAGAGUUUGAUCCUGGCUCAGGACGAACGCUGGCGGCAUGCUUAACACAUGCAAGUCGAACGAGCAAAGCA---------------------AUUUGUGUAGUGGCGAACGGGUGCGUA-ACGCGUAAG-AACCUACCUAUCGG---------------------AGGGGGAUAACAUUGGGAAACUGUUGCUAAUACCCCAUACAGCUGA------GGAGU----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAGGUGAAA---AACCGCCGAUAGAGGGGCUUGCGUCUGAUUAGCUAGUUGGUGGGGGUAACGG----CCUCCCAAGGCCACGAGCAGU-AGCUGGUCUGAGAGGAUGAUCAGCCAC--ACUGGGACUGAGACACGGCCCAGACUCC-UACG-GGAGGCAGCAGUGAGGAAUUUUUCGCAAUGGGCGCAAGCGACGGAGCAAUGCCGCGUGCAGGAAGAAGGCCUGUGGGUCGUAAACUGCUUUUCUCAGAGAAGAAGUUCUGACGGUAUCUGAGGAAUAAGCACCGGCUAACUCUGUGCCAGCAGCCGCGGUAAUACAGAGGGUGCAAGCGUUGUCCGCAAUGAUUGGGCGUAAAGCGUCUGUAGGUGGCUCGUAAAGUCUAAUGUCAAAUACCAGGGCUCAACCUUGGACCGGCAUUGGAGUACUCACGAGCUUGAGUACGGUAGGGGCAGAGGGAAUUCCAUGUGGAGCGGUGAAAUGCGUAGAGAUAUGGAGGAACACCAGUGGCGAAGGCGCUCUGCUGGGCCGAAACUGACACUGAGAGACGAAAGCUGGGGGAGCGAAUAGGAUUAGAUACCCUAGUAGUCCCAGCCGUAAACUAUGGAGACUAAGUGCUGCCGCAAGCAGUGCUGUAGCUAACGCGUUAAGUCUCCCGCCUGGGGAGUAUGCUCGCAAGAGUGAAACUCAAAGGAAUUGACGGGACCGCACAAGCGGUGGAUUAUGUGGAUUAAUUCGAUACAACGCGAAGAACCUUACCAGGGUUUGACAUGUCAAGAACCUCUCAGAAAUGGGAGGGUGCCCUAACGGACUUGAACACAGGUGGUGCAUGGCUGUCGUCAGCUCGUGCUGUGAAGUGUAUAGUUAAGUCUCAUAACGAGCGCAACCCUCGUCUUUAGUUGCCAUUUGGUUCUCUAAAGAGACUGCCAGUGUAAGCUGGAGGAAGGUGAGGAUGACGUCAAGUCAGCAUGCCCCUUACAUCCUGGGCUUCACACGUAAUACAAUGGUUGGGACAAUCAGAAGCGACUCGUGAGAGCUAGCGGCUCUGUUAAACCCAACCUCAGUUCGGAUUGUAGGCUGCAACUCGCCUACAUGAAGCCGGAAUCGCUAGUAAUCGCCAGUCAGCUAUAUGGCGGUGAAUACGUUCCCGGGUCUUGUACACACCGCCCGUCACACCAUGGAAGCUGGUUCUGCUCCAAGUCGUUACCCUAACCUUCGGGAGGGGGGCGCCUAAAGCAGGGCUAGUGACUAGGGUGAAGUCGUAACAAGGUAG-GGCUACUG--------------GAAGGUGGCCCUGGCUCACCUCCUUC-
>3CC2 0   U---------------------------AU-GCCAGCUGG-----UGGAUU------GCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCUGUGGGGAGCCGCACGGAGGCGAAGAACCACAGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUG-----------AGGAACCCCG--------------AGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAACGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUUCACGAAGUCUCUUGGAAUAGAGCGUGAUACAGGGUGACAACCCCGUACUGAAGACCAGUACGCUGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUUGACGAAUGACCGAGACGCGAGUCUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGUAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCUGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGCAGGGGCGAGAGCUCCUGUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCUCACCGCAACUCGACUGAGACGAAAUGGGAAACAGGUUAAUAUUCCUGUGCCAUCAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCCGGGCAUCGCCCGGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUGAUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGUCAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUGACUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCG-UAUAGUACGAGAGGAACUACGGU--UGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGG-----------UAG---CCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAACC-CACUUGGAAAAGAGACACC------------------------------------------------GCCGAGGUCCCGCGUA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAAGACGCGGUCGAUAG--ACUCGGGGU----GUGCGCG----UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.054
0.067
RF00177 1YHQ_0
>Target   AUCCAUGGAGAGUUUGAUCCUGGCUCAGGACGAACGCUGGCGGCAUGCUUAACACAUGCAAGUCGAACGAGCAAAGCA---------------------AUUUGUGUAGUGGCGAACGGGUGCGUA-ACGCGUAAG-AACCUACCUAUCGG---------------------AGGGGGAUAACAUUGGGAAACUGUUGCUAAUACCCCAUACAGCUGA------GGAGU----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAGGUGAAA---AACCGCCGAUAGAGGGGCUUGCGUCUGAUUAGCUAGUUGGUGGGGGUAACGG----CCUCCCAAGGCCACGAGCAGU-AGCUGGUCUGAGAGGAUGAUCAGCCAC--ACUGGGACUGAGACACGGCCCAGACUCC-UACG-GGAGGCAGCAGUGAGGAAUUUUUCGCAAUGGGCGCAAGCGACGGAGCAAUGCCGCGUGCAGGAAGAAGGCCUGUGGGUCGUAAACUGCUUUUCUCAGAGAAGAAGUUCUGACGGUAUCUGAGGAAUAAGCACCGGCUAACUCUGUGCCAGCAGCCGCGGUAAUACAGAGGGUGCAAGCGUUGUCCGCAAUGAUUGGGCGUAAAGCGUCUGUAGGUGGCUCGUAAAGUCUAAUGUCAAAUACCAGGGCUCAACCUUGGACCGGCAUUGGAGUACUCACGAGCUUGAGUACGGUAGGGGCAGAGGGAAUUCCAUGUGGAGCGGUGAAAUGCGUAGAGAUAUGGAGGAACACCAGUGGCGAAGGCGCUCUGCUGGGCCGAAACUGACACUGAGAGACGAAAGCUGGGGGAGCGAAUAGGAUUAGAUACCCUAGUAGUCCCAGCCGUAAACUAUGGAGACUAAGUGCUGCCGCAAGCAGUGCUGUAGCUAACGCGUUAAGUCUCCCGCCUGGGGAGUAUGCUCGCAAGAGUGAAACUCAAAGGAAUUGACGGGACCGCACAAGCGGUGGAUUAUGUGGAUUAAUUCGAUACAACGCGAAGAACCUUACCAGGGUUUGACAUGUCAAGAACCUCUCAGAAAUGGGAGGGUGCCCUAACGGACUUGAACACAGGUGGUGCAUGGCUGUCGUCAGCUCGUGCUGUGAAGUGUAUAGUUAAGUCUCAUAACGAGCGCAACCCUCGUCUUUAGUUGCCAUUUGGUUCUCUAAAGAGACUGCCAGUGUAAGCUGGAGGAAGGUGAGGAUGACGUCAAGUCAGCAUGCCCCUUACAUCCUGGGCUUCACACGUAAUACAAUGGUUGGGACAAUCAGAAGCGACUCGUGAGAGCUAGCGGCUCUGUUAAACCCAACCUCAGUUCGGAUUGUAGGCUGCAACUCGCCUACAUGAAGCCGGAAUCGCUAGUAAUCGCCAGUCAGCUAUAUGGCGGUGAAUACGUUCCCGGGUCUUGUACACACCGCCCGUCACACCAUGGAAGCUGGUUCUGCUCCAAGUCGUUACCCUAACCUUCGGGAGGGGGGCGCCUAAAGCAGGGCUAGUGACUAGGGUGAAGUCGUAACAAGGUAG-GGCUACUG--------------GAAGGUGGCCCUGGCUCACCUCCUUC-
>1YHQ 0   U---------------------------AU-GCCAGCUGG-----UGGAUU------GCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCUGUGGGGAGCCGCACGGAGGCGAAGAACCACAGAUUUCCGAAUGAGAAUCUCUAACAAUUGCUUCGCGCAAUG-----------AGGAACCCCG--------------AGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAACGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUUCACGAAGUCUCUUGGAAUAGAGCGUGAUACAGGGUGACAACCCCGUACUGAAGACCAGUACGCUGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUUGACGAAUGACCGAGACGCGAGUCUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGUAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCUGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGCAGGGGCGAGAGCUCCUGUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCUCACCGCAACUCGACUGAGACGAAAUGGGAAACAGGUUAAUAUUCCUGUGCCAUCAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCCGGGCAUCGCCCGGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUGAUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCAAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGUCAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUGACUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCG-UAUAGUACGAGAGGAACUACGGU--UGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGG-----------UAG---CCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAACC-CACUUGGAAAAGAGACACC------------------------------------------------GCCGAGGUCCCGCGUA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAAGACGCGGUCGAUAG--ACUCGGGGU----GUGCGCG----UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.054
0.067
RF00177 1VQO_0
>Target   AUCCAUGGAGAGUUUGAUCCUGGCUCAGGACGAACGCUGGCGGCAUGCUUAACACAUGCAAGUCGAACGAGCAAAGCA------AUUUGUGUAGUGGCGAACGGGUGCGUAACGCGUAAGAACCUACCUAUCGG---AGGGGGAUAACAUUGGGAAACUGUUGCUAAUACCCCAUACAGCUGA-----GGAGU----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAGGUGAAA---AACCGCCGAUAGAGGGGCUUGCGUCUGAUUAGCUAGUUGGUGGGGGUAACGG----CCUCCCAAGGCCACGAGCAGU-AGCUGGUCUGAGAGGAUGAUCAGC--CACACUGGGACUGAGACACGGCCCAGACUCC-UACG-GGAGGCAGCAGUGAGGAAUUUUUCGCAAUGGGCGCAAGCGACGGAGCAAUGCCGCGUGCAGGAAGAAGGCCUGUGGGUCGUAAACUGCUUUUCUCAGAGAAGAAGUUCUGACGGUAUCUGAGGAAUAAGCACCGGCUAACUCUGUGCCAGCAGCCGCGGUAAUACAGAGGGUGCAAGCGUUGUCCGCAAUGAUUGGGCGUAAAGCGUCUGUAGGUGGCUCGUAAAGUCUAAUGUCAAAUACCAGGGCUCAACCUUGGACCGGCAUUGGAGUACUCACGAGCUUGAGUACGGUAGGGGCAGAGGGAAUUCCAUGUGGAGCGGUGAAAUGCGUAGAGAUAUGGAGGAACACCAGUGGCGAAGGCGCUCUGCUGGGCCGAAACUGACACUGAGAGACGAAAGCUGGGGGAGCGAAUAGGAUUAGAUACCCUAGUAGUCCCAGCCGUAAACUAUGGAGACUAAGUGCUGCCGCAAGCAGUGCUGUAGCUAACGCGUUAAGUCUCCCGCCUGGGGAGUAUGCUCGCAAGAGUGAAACUCAAAGGAAUUGACGGGACCGCACAAGCGGUGGAUUAUGUGGAUUAAUUCGAUACAACGCGAAGAACCUUACCAGGGUUUGACAUGUCAAGAACCUCUCAGAAAUGGGAGGGUGCCCUAACGGACUUGAACACAGGUGGUGCAUGGCUGUCGUCAGCUCGUGCUGUGAAGUGUAUAGUUAAGUCUCAUAACGAGCGCAACCCUCGUCUUUAGUUGCCAUUUGGUUCUCUAAAGAGACUGCCAGUGUAAGCUGGAGGAAGGUGAGGAUGACGUCAAGUCAGCAUGCCCCUUACAUCCUGGGCUUCACACGUAAUACAAUGGUUGGGACAAUCAGAAGCGACUCGUGAGAGCUAGCGGCUCUGUUAAACCCAACCUCAGUUCGGAUUGUAGGCUGCAACUCGCCUACAUGAAGCCGGAAUCGCUAGUAAUCGCCAGUCAGCUAUAUGGCGGUGAAUACGUUCCCGGGUCUUGUACACACCGCCCGUCACACCAUGGAAGCUGGUUCUGCUCCAAGUCGUUACCCUAACCUUCGGGAGGGGGGCGCCUAAAGCAGGGCUAGUGACUAGGGUGAAGUCGUAACAAGGUAG-GGCUACUG--------------GAAGGUGGCCCUGGCUCACCUCCUUC-
>1VQO 0   U---------------------------AU-GCCAGCUGG-----UGGAUU------GCUC-----------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAU-AAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACA---AUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCG-UAUAGUACGAGAGGAACUACGGU--UGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGG--------------UAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAACC-CACUUGGAAAAGAGACACCGCCGAGG-UCCCG----CGUACAAGAC---------------------GCGGU---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAUAG--ACUCGGGGU----GUGCGCG----UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.05
0.063
RF00177 1VQ9_0
>Target   AUCCAUGGAGAGUUUGAUCCUGGCUCAGGACGAACGCUGGCGGCAUGCUUAACACAUGCAAGUCGAACGAGCAAAGCA------AUUUGUGUAGUGGCGAACGGGUGCGUAACGCGUAAGAACCUACCUAUCGG---AGGGGGAUAACAUUGGGAAACUGUUGCUAAUACCCCAUACAGCUGA-----GGAGU----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAGGUGAAA---AACCGCCGAUAGAGGGGCUUGCGUCUGAUUAGCUAGUUGGUGGGGGUAACGG----CCUCCCAAGGCCACGAGCAGU-AGCUGGUCUGAGAGGAUGAUCAGC--CACACUGGGACUGAGACACGGCCCAGACUCC-UACG-GGAGGCAGCAGUGAGGAAUUUUUCGCAAUGGGCGCAAGCGACGGAGCAAUGCCGCGUGCAGGAAGAAGGCCUGUGGGUCGUAAACUGCUUUUCUCAGAGAAGAAGUUCUGACGGUAUCUGAGGAAUAAGCACCGGCUAACUCUGUGCCAGCAGCCGCGGUAAUACAGAGGGUGCAAGCGUUGUCCGCAAUGAUUGGGCGUAAAGCGUCUGUAGGUGGCUCGUAAAGUCUAAUGUCAAAUACCAGGGCUCAACCUUGGACCGGCAUUGGAGUACUCACGAGCUUGAGUACGGUAGGGGCAGAGGGAAUUCCAUGUGGAGCGGUGAAAUGCGUAGAGAUAUGGAGGAACACCAGUGGCGAAGGCGCUCUGCUGGGCCGAAACUGACACUGAGAGACGAAAGCUGGGGGAGCGAAUAGGAUUAGAUACCCUAGUAGUCCCAGCCGUAAACUAUGGAGACUAAGUGCUGCCGCAAGCAGUGCUGUAGCUAACGCGUUAAGUCUCCCGCCUGGGGAGUAUGCUCGCAAGAGUGAAACUCAAAGGAAUUGACGGGACCGCACAAGCGGUGGAUUAUGUGGAUUAAUUCGAUACAACGCGAAGAACCUUACCAGGGUUUGACAUGUCAAGAACCUCUCAGAAAUGGGAGGGUGCCCUAACGGACUUGAACACAGGUGGUGCAUGGCUGUCGUCAGCUCGUGCUGUGAAGUGUAUAGUUAAGUCUCAUAACGAGCGCAACCCUCGUCUUUAGUUGCCAUUUGGUUCUCUAAAGAGACUGCCAGUGUAAGCUGGAGGAAGGUGAGGAUGACGUCAAGUCAGCAUGCCCCUUACAUCCUGGGCUUCACACGUAAUACAAUGGUUGGGACAAUCAGAAGCGACUCGUGAGAGCUAGCGGCUCUGUUAAACCCAACCUCAGUUCGGAUUGUAGGCUGCAACUCGCCUACAUGAAGCCGGAAUCGCUAGUAAUCGCCAGUCAGCUAUAUGGCGGUGAAUACGUUCCCGGGUCUUGUACACACCGCCCGUCACACCAUGGAAGCUGGUUCUGCUCCAAGUCGUUACCCUAACCUUCGGGAGGGGGGCGCCUAAAGCAGGGCUAGUGACUAGGGUGAAGUCGUAACAAGGUAG-GGCUACUG--------------GAAGGUGGCCCUGGCUCACCUCCUUC-
>1VQ9 0   U---------------------------AU-GCCAGCUGG-----UGGAUU------GCUC-----------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAU-AAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACA---AUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCG-UAUAGUACGAGAGGAACUACGGU--UGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGG--------------UAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAACC-CACUUGGAAAAGAGACACCGCCGAGG-UCCCG----CGUACAAGAC---------------------GCGGU---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAUAG--ACUCGGGGU----GUGCGCG----UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.05
0.063
RF00177 1VQN_0
>Target   AUCCAUGGAGAGUUUGAUCCUGGCUCAGGACGAACGCUGGCGGCAUGCUUAACACAUGCAAGUCGAACGAGCAAAGCA------AUUUGUGUAGUGGCGAACGGGUGCGUAACGCGUAAGAACCUACCUAUCGG---AGGGGGAUAACAUUGGGAAACUGUUGCUAAUACCCCAUACAGCUGA-----GGAGU----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAGGUGAAA---AACCGCCGAUAGAGGGGCUUGCGUCUGAUUAGCUAGUUGGUGGGGGUAACGG----CCUCCCAAGGCCACGAGCAGU-AGCUGGUCUGAGAGGAUGAUCAGC--CACACUGGGACUGAGACACGGCCCAGACUCC-UACG-GGAGGCAGCAGUGAGGAAUUUUUCGCAAUGGGCGCAAGCGACGGAGCAAUGCCGCGUGCAGGAAGAAGGCCUGUGGGUCGUAAACUGCUUUUCUCAGAGAAGAAGUUCUGACGGUAUCUGAGGAAUAAGCACCGGCUAACUCUGUGCCAGCAGCCGCGGUAAUACAGAGGGUGCAAGCGUUGUCCGCAAUGAUUGGGCGUAAAGCGUCUGUAGGUGGCUCGUAAAGUCUAAUGUCAAAUACCAGGGCUCAACCUUGGACCGGCAUUGGAGUACUCACGAGCUUGAGUACGGUAGGGGCAGAGGGAAUUCCAUGUGGAGCGGUGAAAUGCGUAGAGAUAUGGAGGAACACCAGUGGCGAAGGCGCUCUGCUGGGCCGAAACUGACACUGAGAGACGAAAGCUGGGGGAGCGAAUAGGAUUAGAUACCCUAGUAGUCCCAGCCGUAAACUAUGGAGACUAAGUGCUGCCGCAAGCAGUGCUGUAGCUAACGCGUUAAGUCUCCCGCCUGGGGAGUAUGCUCGCAAGAGUGAAACUCAAAGGAAUUGACGGGACCGCACAAGCGGUGGAUUAUGUGGAUUAAUUCGAUACAACGCGAAGAACCUUACCAGGGUUUGACAUGUCAAGAACCUCUCAGAAAUGGGAGGGUGCCCUAACGGACUUGAACACAGGUGGUGCAUGGCUGUCGUCAGCUCGUGCUGUGAAGUGUAUAGUUAAGUCUCAUAACGAGCGCAACCCUCGUCUUUAGUUGCCAUUUGGUUCUCUAAAGAGACUGCCAGUGUAAGCUGGAGGAAGGUGAGGAUGACGUCAAGUCAGCAUGCCCCUUACAUCCUGGGCUUCACACGUAAUACAAUGGUUGGGACAAUCAGAAGCGACUCGUGAGAGCUAGCGGCUCUGUUAAACCCAACCUCAGUUCGGAUUGUAGGCUGCAACUCGCCUACAUGAAGCCGGAAUCGCUAGUAAUCGCCAGUCAGCUAUAUGGCGGUGAAUACGUUCCCGGGUCUUGUACACACCGCCCGUCACACCAUGGAAGCUGGUUCUGCUCCAAGUCGUUACCCUAACCUUCGGGAGGGGGGCGCCUAAAGCAGGGCUAGUGACUAGGGUGAAGUCGUAACAAGGUAG-GGCUACUG--------------GAAGGUGGCCCUGGCUCACCUCCUUC-
>1VQN 0   U---------------------------AU-GCCAGCUGG-----UGGAUU------GCUC-----------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAU-AAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACA---AUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCG-UAUAGUACGAGAGGAACUACGGU--UGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGG--------------UAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAACC-CACUUGGAAAAGAGACACCGCCGAGG-UCCCG----CGUACAAGAC---------------------GCGGU---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAUAG--ACUCGGGGU----GUGCGCG----UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.05
0.063
RF00177 1S72_0
>Target   AUCCAUGGAGAGUUUGAUCCUGGCUCAGGACGAACGCUGGCGGCAUGCUUAACACAUGCAAGUCGAACGAGCAAAGCA------AUUUGUGUAGUGGCGAACGGGUGCGUAACGCGUAAGAACCUACCUAUCGG---AGGGGGAUAACAUUGGGAAACUGUUGCUAAUACCCCAUACAGCUGA-----GGAGU----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAGGUGAAA---AACCGCCGAUAGAGGGGCUUGCGUCUGAUUAGCUAGUUGGUGGGGGUAACGG----CCUCCCAAGGCCACGAGCAGU-AGCUGGUCUGAGAGGAUGAUCAGC--CACACUGGGACUGAGACACGGCCCAGACUCC-UACG-GGAGGCAGCAGUGAGGAAUUUUUCGCAAUGGGCGCAAGCGACGGAGCAAUGCCGCGUGCAGGAAGAAGGCCUGUGGGUCGUAAACUGCUUUUCUCAGAGAAGAAGUUCUGACGGUAUCUGAGGAAUAAGCACCGGCUAACUCUGUGCCAGCAGCCGCGGUAAUACAGAGGGUGCAAGCGUUGUCCGCAAUGAUUGGGCGUAAAGCGUCUGUAGGUGGCUCGUAAAGUCUAAUGUCAAAUACCAGGGCUCAACCUUGGACCGGCAUUGGAGUACUCACGAGCUUGAGUACGGUAGGGGCAGAGGGAAUUCCAUGUGGAGCGGUGAAAUGCGUAGAGAUAUGGAGGAACACCAGUGGCGAAGGCGCUCUGCUGGGCCGAAACUGACACUGAGAGACGAAAGCUGGGGGAGCGAAUAGGAUUAGAUACCCUAGUAGUCCCAGCCGUAAACUAUGGAGACUAAGUGCUGCCGCAAGCAGUGCUGUAGCUAACGCGUUAAGUCUCCCGCCUGGGGAGUAUGCUCGCAAGAGUGAAACUCAAAGGAAUUGACGGGACCGCACAAGCGGUGGAUUAUGUGGAUUAAUUCGAUACAACGCGAAGAACCUUACCAGGGUUUGACAUGUCAAGAACCUCUCAGAAAUGGGAGGGUGCCCUAACGGACUUGAACACAGGUGGUGCAUGGCUGUCGUCAGCUCGUGCUGUGAAGUGUAUAGUUAAGUCUCAUAACGAGCGCAACCCUCGUCUUUAGUUGCCAUUUGGUUCUCUAAAGAGACUGCCAGUGUAAGCUGGAGGAAGGUGAGGAUGACGUCAAGUCAGCAUGCCCCUUACAUCCUGGGCUUCACACGUAAUACAAUGGUUGGGACAAUCAGAAGCGACUCGUGAGAGCUAGCGGCUCUGUUAAACCCAACCUCAGUUCGGAUUGUAGGCUGCAACUCGCCUACAUGAAGCCGGAAUCGCUAGUAAUCGCCAGUCAGCUAUAUGGCGGUGAAUACGUUCCCGGGUCUUGUACACACCGCCCGUCACACCAUGGAAGCUGGUUCUGCUCCAAGUCGUUACCCUAACCUUCGGGAGGGGGGCGCCUAAAGCAGGGCUAGUGACUAGGGUGAAGUCGUAACAAGGUAG-GGCUACUG--------------GAAGGUGGCCCUGGCUCACCUCCUUC-
>1S72 0   U---------------------------AU-GCCAGCUGG-----UGGAUU------GCUC-----------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAU-AAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACA---AUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCG-UAUAGUACGAGAGGAACUACGGU--UGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGG--------------UAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAACC-CACUUGGAAAAGAGACACCGCCGAGG-UCCCG----CGUACAAGAC---------------------GCGGU---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAUAG--ACUCGGGGU----GUGCGCG----UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.05
0.063
RF00177 1VQL_0
>Target   AUCCAUGGAGAGUUUGAUCCUGGCUCAGGACGAACGCUGGCGGCAUGCUUAACACAUGCAAGUCGAACGAGCAAAGCA------AUUUGUGUAGUGGCGAACGGGUGCGUAACGCGUAAGAACCUACCUAUCGG---AGGGGGAUAACAUUGGGAAACUGUUGCUAAUACCCCAUACAGCUGA-----GGAGU----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAGGUGAAA---AACCGCCGAUAGAGGGGCUUGCGUCUGAUUAGCUAGUUGGUGGGGGUAACGG----CCUCCCAAGGCCACGAGCAGU-AGCUGGUCUGAGAGGAUGAUCAGC--CACACUGGGACUGAGACACGGCCCAGACUCC-UACG-GGAGGCAGCAGUGAGGAAUUUUUCGCAAUGGGCGCAAGCGACGGAGCAAUGCCGCGUGCAGGAAGAAGGCCUGUGGGUCGUAAACUGCUUUUCUCAGAGAAGAAGUUCUGACGGUAUCUGAGGAAUAAGCACCGGCUAACUCUGUGCCAGCAGCCGCGGUAAUACAGAGGGUGCAAGCGUUGUCCGCAAUGAUUGGGCGUAAAGCGUCUGUAGGUGGCUCGUAAAGUCUAAUGUCAAAUACCAGGGCUCAACCUUGGACCGGCAUUGGAGUACUCACGAGCUUGAGUACGGUAGGGGCAGAGGGAAUUCCAUGUGGAGCGGUGAAAUGCGUAGAGAUAUGGAGGAACACCAGUGGCGAAGGCGCUCUGCUGGGCCGAAACUGACACUGAGAGACGAAAGCUGGGGGAGCGAAUAGGAUUAGAUACCCUAGUAGUCCCAGCCGUAAACUAUGGAGACUAAGUGCUGCCGCAAGCAGUGCUGUAGCUAACGCGUUAAGUCUCCCGCCUGGGGAGUAUGCUCGCAAGAGUGAAACUCAAAGGAAUUGACGGGACCGCACAAGCGGUGGAUUAUGUGGAUUAAUUCGAUACAACGCGAAGAACCUUACCAGGGUUUGACAUGUCAAGAACCUCUCAGAAAUGGGAGGGUGCCCUAACGGACUUGAACACAGGUGGUGCAUGGCUGUCGUCAGCUCGUGCUGUGAAGUGUAUAGUUAAGUCUCAUAACGAGCGCAACCCUCGUCUUUAGUUGCCAUUUGGUUCUCUAAAGAGACUGCCAGUGUAAGCUGGAGGAAGGUGAGGAUGACGUCAAGUCAGCAUGCCCCUUACAUCCUGGGCUUCACACGUAAUACAAUGGUUGGGACAAUCAGAAGCGACUCGUGAGAGCUAGCGGCUCUGUUAAACCCAACCUCAGUUCGGAUUGUAGGCUGCAACUCGCCUACAUGAAGCCGGAAUCGCUAGUAAUCGCCAGUCAGCUAUAUGGCGGUGAAUACGUUCCCGGGUCUUGUACACACCGCCCGUCACACCAUGGAAGCUGGUUCUGCUCCAAGUCGUUACCCUAACCUUCGGGAGGGGGGCGCCUAAAGCAGGGCUAGUGACUAGGGUGAAGUCGUAACAAGGUAG-GGCUACUG--------------GAAGGUGGCCCUGGCUCACCUCCUUC-
>1VQL 0   U---------------------------AU-GCCAGCUGG-----UGGAUU------GCUC-----------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAU-AAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACA---AUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCG-UAUAGUACGAGAGGAACUACGGU--UGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGG--------------UAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAACC-CACUUGGAAAAGAGACACCGCCGAGG-UCCCG----CGUACAAGAC---------------------GCGGU---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAUAG--ACUCGGGGU----GUGCGCG----UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.05
0.063
RF00177 1VQM_0
>Target   AUCCAUGGAGAGUUUGAUCCUGGCUCAGGACGAACGCUGGCGGCAUGCUUAACACAUGCAAGUCGAACGAGCAAAGCA------AUUUGUGUAGUGGCGAACGGGUGCGUAACGCGUAAGAACCUACCUAUCGG---AGGGGGAUAACAUUGGGAAACUGUUGCUAAUACCCCAUACAGCUGA-----GGAGU----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAGGUGAAA---AACCGCCGAUAGAGGGGCUUGCGUCUGAUUAGCUAGUUGGUGGGGGUAACGG----CCUCCCAAGGCCACGAGCAGU-AGCUGGUCUGAGAGGAUGAUCAGC--CACACUGGGACUGAGACACGGCCCAGACUCC-UACG-GGAGGCAGCAGUGAGGAAUUUUUCGCAAUGGGCGCAAGCGACGGAGCAAUGCCGCGUGCAGGAAGAAGGCCUGUGGGUCGUAAACUGCUUUUCUCAGAGAAGAAGUUCUGACGGUAUCUGAGGAAUAAGCACCGGCUAACUCUGUGCCAGCAGCCGCGGUAAUACAGAGGGUGCAAGCGUUGUCCGCAAUGAUUGGGCGUAAAGCGUCUGUAGGUGGCUCGUAAAGUCUAAUGUCAAAUACCAGGGCUCAACCUUGGACCGGCAUUGGAGUACUCACGAGCUUGAGUACGGUAGGGGCAGAGGGAAUUCCAUGUGGAGCGGUGAAAUGCGUAGAGAUAUGGAGGAACACCAGUGGCGAAGGCGCUCUGCUGGGCCGAAACUGACACUGAGAGACGAAAGCUGGGGGAGCGAAUAGGAUUAGAUACCCUAGUAGUCCCAGCCGUAAACUAUGGAGACUAAGUGCUGCCGCAAGCAGUGCUGUAGCUAACGCGUUAAGUCUCCCGCCUGGGGAGUAUGCUCGCAAGAGUGAAACUCAAAGGAAUUGACGGGACCGCACAAGCGGUGGAUUAUGUGGAUUAAUUCGAUACAACGCGAAGAACCUUACCAGGGUUUGACAUGUCAAGAACCUCUCAGAAAUGGGAGGGUGCCCUAACGGACUUGAACACAGGUGGUGCAUGGCUGUCGUCAGCUCGUGCUGUGAAGUGUAUAGUUAAGUCUCAUAACGAGCGCAACCCUCGUCUUUAGUUGCCAUUUGGUUCUCUAAAGAGACUGCCAGUGUAAGCUGGAGGAAGGUGAGGAUGACGUCAAGUCAGCAUGCCCCUUACAUCCUGGGCUUCACACGUAAUACAAUGGUUGGGACAAUCAGAAGCGACUCGUGAGAGCUAGCGGCUCUGUUAAACCCAACCUCAGUUCGGAUUGUAGGCUGCAACUCGCCUACAUGAAGCCGGAAUCGCUAGUAAUCGCCAGUCAGCUAUAUGGCGGUGAAUACGUUCCCGGGUCUUGUACACACCGCCCGUCACACCAUGGAAGCUGGUUCUGCUCCAAGUCGUUACCCUAACCUUCGGGAGGGGGGCGCCUAAAGCAGGGCUAGUGACUAGGGUGAAGUCGUAACAAGGUAG-GGCUACUG--------------GAAGGUGGCCCUGGCUCACCUCCUUC-
>1VQM 0   U---------------------------AU-GCCAGCUGG-----UGGAUU------GCUC-----------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAU-AAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACA---AUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCG-UAUAGUACGAGAGGAACUACGGU--UGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGG--------------UAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAACC-CACUUGGAAAAGAGACACCGCCGAGG-UCCCG----CGUACAAGAC---------------------GCGGU---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAUAG--ACUCGGGGU----GUGCGCG----UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.05
0.063
RF00177 1JJ2_0
>Target   AUCCAUGGAGAGUUUGAUCCUGGCUCAGGACGAACGCUGGCGGCAUGCUUAACACAUGCAAGUCGAACGAGCAAAGCA------AUUUGUGUAGUGGCGAACGGGUGCGUAACGCGUAAGAACCUACCUAUCGG---AGGGGGAUAACAUUGGGAAACUGUUGCUAAUACCCCAUACAGCUGA-----GGAGU----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAGGUGAAA---AACCGCCGAUAGAGGGGCUUGCGUCUGAUUAGCUAGUUGGUGGGGGUAACGG----CCUCCCAAGGCCACGAGCAGU-AGCUGGUCUGAGAGGAUGAUCAGC--CACACUGGGACUGAGACACGGCCCAGACUCC-UACG-GGAGGCAGCAGUGAGGAAUUUUUCGCAAUGGGCGCAAGCGACGGAGCAAUGCCGCGUGCAGGAAGAAGGCCUGUGGGUCGUAAACUGCUUUUCUCAGAGAAGAAGUUCUGACGGUAUCUGAGGAAUAAGCACCGGCUAACUCUGUGCCAGCAGCCGCGGUAAUACAGAGGGUGCAAGCGUUGUCCGCAAUGAUUGGGCGUAAAGCGUCUGUAGGUGGCUCGUAAAGUCUAAUGUCAAAUACCAGGGCUCAACCUUGGACCGGCAUUGGAGUACUCACGAGCUUGAGUACGGUAGGGGCAGAGGGAAUUCCAUGUGGAGCGGUGAAAUGCGUAGAGAUAUGGAGGAACACCAGUGGCGAAGGCGCUCUGCUGGGCCGAAACUGACACUGAGAGACGAAAGCUGGGGGAGCGAAUAGGAUUAGAUACCCUAGUAGUCCCAGCCGUAAACUAUGGAGACUAAGUGCUGCCGCAAGCAGUGCUGUAGCUAACGCGUUAAGUCUCCCGCCUGGGGAGUAUGCUCGCAAGAGUGAAACUCAAAGGAAUUGACGGGACCGCACAAGCGGUGGAUUAUGUGGAUUAAUUCGAUACAACGCGAAGAACCUUACCAGGGUUUGACAUGUCAAGAACCUCUCAGAAAUGGGAGGGUGCCCUAACGGACUUGAACACAGGUGGUGCAUGGCUGUCGUCAGCUCGUGCUGUGAAGUGUAUAGUUAAGUCUCAUAACGAGCGCAACCCUCGUCUUUAGUUGCCAUUUGGUUCUCUAAAGAGACUGCCAGUGUAAGCUGGAGGAAGGUGAGGAUGACGUCAAGUCAGCAUGCCCCUUACAUCCUGGGCUUCACACGUAAUACAAUGGUUGGGACAAUCAGAAGCGACUCGUGAGAGCUAGCGGCUCUGUUAAACCCAACCUCAGUUCGGAUUGUAGGCUGCAACUCGCCUACAUGAAGCCGGAAUCGCUAGUAAUCGCCAGUCAGCUAUAUGGCGGUGAAUACGUUCCCGGGUCUUGUACACACCGCCCGUCACACCAUGGAAGCUGGUUCUGCUCCAAGUCGUUACCCUAACCUUCGGGAGGGGGGCGCCUAAAGCAGGGCUAGUGACUAGGGUGAAGUCGUAACAAGGUAG-GGCUACUG--------------GAAGGUGGCCCUGGCUCACCUCCUUC-
>1JJ2 0   U---------------------------AU-GCCAGCUGG-----UGGAUU------GCUC-----------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAU-AAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACA---AUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUGAAAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUUGUUCGCCUAUUAAAGGAGGUCGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCG-UAUAGUACGAGAGGAACUACGGU--UGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGG--------------UAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAACC-CACUUGGAAAAGAGACACCGCCGAGG-UCCCG----CGUACAAGAC---------------------GCGGU---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAUAG--ACUCGGGGU----GUGCGCG----UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.05
0.063
RF00177 1VQP_0
>Target   AUCCAUGGAGAGUUUGAUCCUGGCUCAGGACGAACGCUGGCGGCAUGCUUAACACAUGCAAGUCGAACGAGCAAAGCA------AUUUGUGUAGUGGCGAACGGGUGCGUAACGCGUAAGAACCUACCUAUCGG---AGGGGGAUAACAUUGGGAAACUGUUGCUAAUACCCCAUACAGCUGA-----GGAGU----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAGGUGAAA---AACCGCCGAUAGAGGGGCUUGCGUCUGAUUAGCUAGUUGGUGGGGGUAACGG----CCUCCCAAGGCCACGAGCAGU-AGCUGGUCUGAGAGGAUGAUCAGC--CACACUGGGACUGAGACACGGCCCAGACUCC-UACG-GGAGGCAGCAGUGAGGAAUUUUUCGCAAUGGGCGCAAGCGACGGAGCAAUGCCGCGUGCAGGAAGAAGGCCUGUGGGUCGUAAACUGCUUUUCUCAGAGAAGAAGUUCUGACGGUAUCUGAGGAAUAAGCACCGGCUAACUCUGUGCCAGCAGCCGCGGUAAUACAGAGGGUGCAAGCGUUGUCCGCAAUGAUUGGGCGUAAAGCGUCUGUAGGUGGCUCGUAAAGUCUAAUGUCAAAUACCAGGGCUCAACCUUGGACCGGCAUUGGAGUACUCACGAGCUUGAGUACGGUAGGGGCAGAGGGAAUUCCAUGUGGAGCGGUGAAAUGCGUAGAGAUAUGGAGGAACACCAGUGGCGAAGGCGCUCUGCUGGGCCGAAACUGACACUGAGAGACGAAAGCUGGGGGAGCGAAUAGGAUUAGAUACCCUAGUAGUCCCAGCCGUAAACUAUGGAGACUAAGUGCUGCCGCAAGCAGUGCUGUAGCUAACGCGUUAAGUCUCCCGCCUGGGGAGUAUGCUCGCAAGAGUGAAACUCAAAGGAAUUGACGGGACCGCACAAGCGGUGGAUUAUGUGGAUUAAUUCGAUACAACGCGAAGAACCUUACCAGGGUUUGACAUGUCAAGAACCUCUCAGAAAUGGGAGGGUGCCCUAACGGACUUGAACACAGGUGGUGCAUGGCUGUCGUCAGCUCGUGCUGUGAAGUGUAUAGUUAAGUCUCAUAACGAGCGCAACCCUCGUCUUUAGUUGCCAUUUGGUUCUCUAAAGAGACUGCCAGUGUAAGCUGGAGGAAGGUGAGGAUGACGUCAAGUCAGCAUGCCCCUUACAUCCUGGGCUUCACACGUAAUACAAUGGUUGGGACAAUCAGAAGCGACUCGUGAGAGCUAGCGGCUCUGUUAAACCCAACCUCAGUUCGGAUUGUAGGCUGCAACUCGCCUACAUGAAGCCGGAAUCGCUAGUAAUCGCCAGUCAGCUAUAUGGCGGUGAAUACGUUCCCGGGUCUUGUACACACCGCCCGUCACACCAUGGAAGCUGGUUCUGCUCCAAGUCGUUACCCUAACCUUCGGGAGGGGGGCGCCUAAAGCAGGGCUAGUGACUAGGGUGAAGUCGUAACAAGGUAG-GGCUACUG--------------GAAGGUGGCCCUGGCUCACCUCCUUC-
>1VQP 0   U---------------------------AU-GCCAGCUGG-----UGGAUU------GCUC-----------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAU-AAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACA---AUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCG-UAUAGUACGAGAGGAACUACGGU--UGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGG--------------UAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAACC-CACUUGGAAAAGAGACACCGCCGAGG-UCCCG----CGUACAAGAC---------------------GCGGU---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAUAG--ACUCGGGGU----GUGCGCG----UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.05
0.063
RF00177 1VQK_0
>Target   AUCCAUGGAGAGUUUGAUCCUGGCUCAGGACGAACGCUGGCGGCAUGCUUAACACAUGCAAGUCGAACGAGCAAAGCA------AUUUGUGUAGUGGCGAACGGGUGCGUAACGCGUAAGAACCUACCUAUCGG---AGGGGGAUAACAUUGGGAAACUGUUGCUAAUACCCCAUACAGCUGA-----GGAGU----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAGGUGAAA---AACCGCCGAUAGAGGGGCUUGCGUCUGAUUAGCUAGUUGGUGGGGGUAACGG----CCUCCCAAGGCCACGAGCAGU-AGCUGGUCUGAGAGGAUGAUCAGC--CACACUGGGACUGAGACACGGCCCAGACUCC-UACG-GGAGGCAGCAGUGAGGAAUUUUUCGCAAUGGGCGCAAGCGACGGAGCAAUGCCGCGUGCAGGAAGAAGGCCUGUGGGUCGUAAACUGCUUUUCUCAGAGAAGAAGUUCUGACGGUAUCUGAGGAAUAAGCACCGGCUAACUCUGUGCCAGCAGCCGCGGUAAUACAGAGGGUGCAAGCGUUGUCCGCAAUGAUUGGGCGUAAAGCGUCUGUAGGUGGCUCGUAAAGUCUAAUGUCAAAUACCAGGGCUCAACCUUGGACCGGCAUUGGAGUACUCACGAGCUUGAGUACGGUAGGGGCAGAGGGAAUUCCAUGUGGAGCGGUGAAAUGCGUAGAGAUAUGGAGGAACACCAGUGGCGAAGGCGCUCUGCUGGGCCGAAACUGACACUGAGAGACGAAAGCUGGGGGAGCGAAUAGGAUUAGAUACCCUAGUAGUCCCAGCCGUAAACUAUGGAGACUAAGUGCUGCCGCAAGCAGUGCUGUAGCUAACGCGUUAAGUCUCCCGCCUGGGGAGUAUGCUCGCAAGAGUGAAACUCAAAGGAAUUGACGGGACCGCACAAGCGGUGGAUUAUGUGGAUUAAUUCGAUACAACGCGAAGAACCUUACCAGGGUUUGACAUGUCAAGAACCUCUCAGAAAUGGGAGGGUGCCCUAACGGACUUGAACACAGGUGGUGCAUGGCUGUCGUCAGCUCGUGCUGUGAAGUGUAUAGUUAAGUCUCAUAACGAGCGCAACCCUCGUCUUUAGUUGCCAUUUGGUUCUCUAAAGAGACUGCCAGUGUAAGCUGGAGGAAGGUGAGGAUGACGUCAAGUCAGCAUGCCCCUUACAUCCUGGGCUUCACACGUAAUACAAUGGUUGGGACAAUCAGAAGCGACUCGUGAGAGCUAGCGGCUCUGUUAAACCCAACCUCAGUUCGGAUUGUAGGCUGCAACUCGCCUACAUGAAGCCGGAAUCGCUAGUAAUCGCCAGUCAGCUAUAUGGCGGUGAAUACGUUCCCGGGUCUUGUACACACCGCCCGUCACACCAUGGAAGCUGGUUCUGCUCCAAGUCGUUACCCUAACCUUCGGGAGGGGGGCGCCUAAAGCAGGGCUAGUGACUAGGGUGAAGUCGUAACAAGGUAG-GGCUACUG--------------GAAGGUGGCCCUGGCUCACCUCCUUC-
>1VQK 0   U---------------------------AU-GCCAGCUGG-----UGGAUU------GCUC-----------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAU-AAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACA---AUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCG-UAUAGUACGAGAGGAACUACGGU--UGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGG--------------UAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAACC-CACUUGGAAAAGAGACACCGCCGAGG-UCCCG----CGUACAAGAC---------------------GCGGU---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAUAG--ACUCGGGGU----GUGCGCG----UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.05
0.063
RF00177 1VQ8_0
>Target   AUCCAUGGAGAGUUUGAUCCUGGCUCAGGACGAACGCUGGCGGCAUGCUUAACACAUGCAAGUCGAACGAGCAAAGCA------AUUUGUGUAGUGGCGAACGGGUGCGUAACGCGUAAGAACCUACCUAUCGG---AGGGGGAUAACAUUGGGAAACUGUUGCUAAUACCCCAUACAGCUGA-----GGAGU----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAGGUGAAA---AACCGCCGAUAGAGGGGCUUGCGUCUGAUUAGCUAGUUGGUGGGGGUAACGG----CCUCCCAAGGCCACGAGCAGU-AGCUGGUCUGAGAGGAUGAUCAGC--CACACUGGGACUGAGACACGGCCCAGACUCC-UACG-GGAGGCAGCAGUGAGGAAUUUUUCGCAAUGGGCGCAAGCGACGGAGCAAUGCCGCGUGCAGGAAGAAGGCCUGUGGGUCGUAAACUGCUUUUCUCAGAGAAGAAGUUCUGACGGUAUCUGAGGAAUAAGCACCGGCUAACUCUGUGCCAGCAGCCGCGGUAAUACAGAGGGUGCAAGCGUUGUCCGCAAUGAUUGGGCGUAAAGCGUCUGUAGGUGGCUCGUAAAGUCUAAUGUCAAAUACCAGGGCUCAACCUUGGACCGGCAUUGGAGUACUCACGAGCUUGAGUACGGUAGGGGCAGAGGGAAUUCCAUGUGGAGCGGUGAAAUGCGUAGAGAUAUGGAGGAACACCAGUGGCGAAGGCGCUCUGCUGGGCCGAAACUGACACUGAGAGACGAAAGCUGGGGGAGCGAAUAGGAUUAGAUACCCUAGUAGUCCCAGCCGUAAACUAUGGAGACUAAGUGCUGCCGCAAGCAGUGCUGUAGCUAACGCGUUAAGUCUCCCGCCUGGGGAGUAUGCUCGCAAGAGUGAAACUCAAAGGAAUUGACGGGACCGCACAAGCGGUGGAUUAUGUGGAUUAAUUCGAUACAACGCGAAGAACCUUACCAGGGUUUGACAUGUCAAGAACCUCUCAGAAAUGGGAGGGUGCCCUAACGGACUUGAACACAGGUGGUGCAUGGCUGUCGUCAGCUCGUGCUGUGAAGUGUAUAGUUAAGUCUCAUAACGAGCGCAACCCUCGUCUUUAGUUGCCAUUUGGUUCUCUAAAGAGACUGCCAGUGUAAGCUGGAGGAAGGUGAGGAUGACGUCAAGUCAGCAUGCCCCUUACAUCCUGGGCUUCACACGUAAUACAAUGGUUGGGACAAUCAGAAGCGACUCGUGAGAGCUAGCGGCUCUGUUAAACCCAACCUCAGUUCGGAUUGUAGGCUGCAACUCGCCUACAUGAAGCCGGAAUCGCUAGUAAUCGCCAGUCAGCUAUAUGGCGGUGAAUACGUUCCCGGGUCUUGUACACACCGCCCGUCACACCAUGGAAGCUGGUUCUGCUCCAAGUCGUUACCCUAACCUUCGGGAGGGGGGCGCCUAAAGCAGGGCUAGUGACUAGGGUGAAGUCGUAACAAGGUAG-GGCUACUG--------------GAAGGUGGCCCUGGCUCACCUCCUUC-
>1VQ8 0   U---------------------------AU-GCCAGCUGG-----UGGAUU------GCUC-----------GGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAU-AAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCU----AACA---AUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUG"AAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUJ#UUCGCCUAUUAAAGGAGGUCGUGAGCUGGGxUPAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAGGUGUCUGACAAGAACGACCG-UAUAGUACGAGAGGAACUACGGU--UGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGG--------------UAGCCACGCCACACGGGGUAAGAGCU-GAACGCAU-CUAAGCUCG----AAACC-CACUUGGAAAAGAGACACCGCCGAGG-UCCCG----CGUACAAGAC---------------------GCGGU---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAUAG--ACUCGGGGU----GUGCGCG----UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.05
0.063
RF00177 1FFK_0
>Target   AUCCAUGGAGAGUUUGAUCCUGGCUCAGGACGAACGCUGGCGGCAUGCU-UAACACAUGC-AAGUCGAACGAGCAAAGCA---------AUUUGUGUAGUGGCGAACGGGUGCGUAACGCGUAAG-AACCUACCUAUCGGAGGGGGAUAACAUUGGGAAA-CUGUUGCUAAUACCCCAUA--CAGCUGA------GGAGU---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAAGGUGA---AA---AACCGCCGAUAGAGGGGCUUGCGUCUGAUUAGCUAGUUGGUGGGGGUAACGGCCUCCCAAGGCCACGAGCAGUAGCUGGUCUGAGAGGAUGAUCAGCCACACUGGGACUGAGACACGGCCCAGACUCCUACGGGAGGCA--GCAGUGAGGAAUUUUUCGCAAUGGGCGCAAGCGACGGAGCAAUGCCGCGUGCAGGAAGAAGGCCUGUGGGUCGUAAACUGCUUUUCUCAGAGAAGAAGUUCUGACGGUAUCUGAGGAAUAAGCACCGGCUAACUCUGUGCCAGCAGCCGCGGUAAUACAGAGGGUGCAAGCGUUGUCCGCAAUGAUUGGGCGUAAAGCGUCUGUAGGUGGCUCGUAAAGUCUAAUGUCAAAUACCAGGGCUCAACCUUGGACCGGCAUUGGAGUACUCACGAGCUUGAGUACGGUAGGGGCAGAGGGAAUUCCAUGUGGAGCGGUGAAAUGCGUAGAGAUAUGGAGGAACACCAGUGGCGAAGGCGCUCUGCUGGGCCGAAACUGACACUGAGAGACGAAAGCUGGGGGAGCGAAUAGGAUUAGAUACCCUAGUAGUCCCAGCCGUAAACUAUGGAGACUAAGUGCUGCCGCAAGCAGUGCUGUAGCUAACGCGUUAAGUCUCCCGCCUGGGGAGUAUGCUCGCAAGAGUGAAACUCAAAGGAAUUGACGGGACCGCACAAGCGGUGGAUUAUGUGGAUUAAUUCGAUACAACGCGAAGAACCUUACCAGGGUUUGACAUGUCAAGAACCUCUCAGAAAUGGGAGGGUGCCCUAACGGACUUGAACACAGGUGGUGCAUGGCUGUCGUCAGCUCGUGCUGUGAAGUGUAUAGUUAAGUCUCAUAACGAGCGCAACCCUCGUCUUUAGUUGCCAUUUGGUUCUCUAAAGAGACUGCCAGUGUAAGCUGGAGGAAGGUGAGGAUGACGUCAAGUCAGCAUGCCCCUUACAUCCUGGGCUUCACACGUAAUACAAUGGUUGGGACAAUCAGAAGCGACUCGUGAGAGCUAGCGGCUCUGUUAAACCCAACCUCAGUUCGGAUUGUAGGCUGCAACUCGCCUACAUGAAGCCGGAAUCGCUAGUAAUCGCCAGUCAGCUAUAUGGCGGUGAAUACGUUCCCGGGUCUUGUACACACCGCCCGUCACACCAUGGAAGCUGGUUCUGCUCCAAGUCGUUACCCUAACCUUCGGGAGGGGGGCGCCUAAAGCAGGGCUAGUGACUAGGGUGAAGUCGUAACAAGGUAG-GGCUACUG--------------GAAGGUGGCCCUGGCUCACCUCCUUC-
>1FFK 0   U---------------------------AU-GCCAGCUGGUGGAUUGCUCGG-CUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUU----UCC-GAAU--------------GAGAAUCUCUA------------CAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUGAAAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUGCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUCCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGGACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGGACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUUGUUCGCCUAUUAAAGGAGGUCGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUGGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUU-GGUG--GCCACUGGUGUACCGGUUGUU--C-GAGAGAGCACGUGCCGGGUAGCCACGCCACA----CGGGGUAAGAGC-UGAACGCAU---CUAAGCUCGAAACCCA-CUUGGA----AAAG--AGACACCGCCGAGG----UCCCGCGUAC-------AAG--ACGCGG----UCGAUAG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACUCGGGGU----GUGCGCG----UCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGAC-CAA
0.048
0.062

RFAM families found for your sequence with PDB structures with the resolution worse than 2.5 Å:
Valid HTML 4.01! Made with Django.