Home
Submit
All results

ModeRNA
Help
Tutorial
Contact

Genesilico Homepage

The results of your job '2ZM5' are ready.


Structure after analysis:
[2ZM5.pdb]

Sequence of a given structure:

GCCCGGAUAGCUCAGUCGGUAGAGCAGGGGAUUGAAAAUCCCCGUGUCCU
UGGUUCGAUUCCGAGUCCG_._._._._._._._._._._._._._._._
._._._._._._.
Download: [.fasta file with the sequence]
Valid HTML 4.01! Made with Django.