Home
Submit
All results

ModeRNA
Help
Tutorial
Contact

Genesilico Homepage

The results of your job 'trna_mutan' are ready.


Structure after analysis:
[trna_mutan.pdb]

Sequence of a given structure:

GUUAAGAUGGCAGGCCCGGUAAUCGCAUAAAACUUAAACUUUACAGUCAG
AGGUUCAAUCCUCUUCUUAACACCA
Download: [.fasta file with the sequence]

Geometry of the structure:

        Unusual bond lengths:
- Residue 906 (X[A]:C1',X[A]:N9): 1.38
- Residue 908 (X[A]:C1',X[A]:N9): 1.38
- Residue 928 (X[A]:C1',X[A]:N9): 1.37
- Residue 935 (X[A]:C1',X[A]:N9): 1.37
- Residue 937 (X[A]:C1',X[A]:N9): 1.37
- Residue 949 (X[A]:C1',X[A]:N9): 1.38
- Residue 957 (X[A]:C1',X[A]:N9): 1.37
- Residue 970 (X[A]:C1',X[A]:N9): 1.38
- Residue 971 (X[A]:C1',X[A]:N9): 1.38
- Residues 919 --- 918 (X:O3',X+1:P): 1.10
- Residues 957 --- 956 (X:O3',X+1:P): 1.84

Unusual bond angles:
- Residues 919 --- 918 (X:C3',X:O3',X+1:P): 74.51
- Residues 937 --- 936 (X:C3',X:O3',X+1:P): 81.21
- Residue 937 (X:C5',X:C4',X:C3'): 89.02
- Residues 919 --- 918 (X:O3',X+1:P,X+1:O5'): 122.14
- Residues 922 --- 923 (X:O3',X+1:P,X+1:O5'): 73.77
- Residues 957 --- 956 (X:O3',X+1:P,X+1:O5'): 122.12

Unusual dihedral angles:
- Residues 919 --- 918 (X:O3',X+1:P,X+1:O5',X+1:C5'): 348.24
- Residues 924 --- 925 (X:O3',X+1:P,X+1:O5',X+1:C5'): 20.00
- Residues 935 --- 934 (X:O3',X+1:P,X+1:O5',X+1:C5'): 337.67
- Residues 922 --- 923 (X:C4',X:C3',X:O3',X+1:P): 19.31
- Residues 924 --- 925 (X:C4',X:C3',X:O3',X+1:P): 86.54
- Residues 937 --- 939 (X:C4',X:C3',X:O3',X+1:P): 79.52
- Residue 916 (X:O5',X:C5',X:C4',X:C3'): 239.50
- Residue 937 (X:O5',X:C5',X:C4',X:C3'): 100.56
- Residue 939 (X:O5',X:C5',X:C4',X:C3'): 133.29
- Residue 939 (X:C5',X:C4',X:C3',X:O3'): 112.77


Clashing residues:
- Residues 908 (A) --- 914 (G) 
- Residues 902 (G) --- 971 (A) 
- Residues 918 (G) --- 957 (A) 
- Residues 918 (G) --- 919 (G) 
- Residues 933 (U) --- 937 (A) 

    
Valid HTML 4.01! Made with Django.