Home
Submit
All results

ModeRNA
Help
Tutorial
Contact

Genesilico Homepage

The results of your job 'test' are ready.


Provided sequence:
GTCGTTGTAGTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGCG

Results for the structures of the resolution better than 2.5 Å:


Rfam Family PDB ID Alingment Identity Similarity .aln file .pdb file
RF00005 1C0A_B
>Target   GTCGTTGTAGTATAGT-GGTAAGTATTCCCGCCTGTCACGCGGGTGA-CCCGGGTTCGATCCCCGGCAACGGC---G
>1C0A B   GGAGCGG4AGUUCAGDCGGDDAGAAUACCUGCCUQUCACGCAGGGG7UCGCGGGTPCGAGUCCCGPCCGUUCCGCCA
0.519
0.683
RF00005 2ZUE_B
>Target   GTCGTTGTAGTATAGT--GGTAAGTATTCCCGCCTGTCACGCGGGTGA-CCCGGGTTCGATCCCCGGCAACGGC-G
>2ZUE B   GGACCGGUAGCCUAGCCAGGACAGGGCGGCGGCCUCCUAAGCCGCAGGUCCGGGGUUCAAAUCCCCGCCGGUCCGC
0.421
0.553
RF00005 2ZUF_B
>Target   GTCGTTGTAGTATAGT--GGTAAGTATTCCCGCCTGTCACGCGGGTGA-CCCGGGTTCGATCCCCGGCAACGGC-G
>2ZUF B   GGACCGGUAGCCUAGCCAGGACAGGGCGGCGGCCUCCUAAGCCGCAGGUCCGGGGUUCAAAUCCCCGCCGGUCCGC
0.421
0.553
RF00005 2DXI_D
>Target   GTCGTTGTAGTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACG---GCG
>2DXI D   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA
0.4
0.581
RF00005 1N78_D
>Target   GTCGTTGTAGTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACG---GCG
>1N78 D   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA
0.4
0.581
RF00005 1N77_D
>Target   GTCGTTGTAGTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACG---GCG
>1N77 D   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA
0.4
0.581
RF00005 2CV1_C
>Target   GTCGTTGTAGTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACG---GCG
>2CV1 C   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA
0.4
0.581
RF00005 2CV0_D
>Target   GTCGTTGTAGTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACG---GCG
>2CV0 D   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA
0.4
0.581
RF00005 2DXI_C
>Target   GTCGTTGTAGTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACG---GCG
>2DXI C   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA
0.4
0.581
RF00005 1QU2_T
>Target   GTCGTTGTAGTATAGT-GGTAAGTATTCCCGCCTGTCACGCGGGTGA-CCCGGGTTCGATCCCCGGCAACGGCG-
>1QU2 T   GGGCUUGUAGCUCAGGUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGGUGGUUCAAGUCCACUCAGGCCCAC
0.4
0.551
RF00005 1N78_C
>Target   GTCGTTGTAGTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACG---GCG
>1N78 C   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA
0.4
0.581
RF00005 1N77_C
>Target   GTCGTTGTAGTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACG---GCG
>1N77 C   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA
0.4
0.581
RF00005 2CV1_D
>Target   GTCGTTGTAGTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACG---GCG
>2CV1 D   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA
0.4
0.581
RF00005 2CV0_C
>Target   GTCGTTGTAGTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACG---GCG
>2CV0 C   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA
0.4
0.581
RF00005 1FFY_T
>Target   GTCGTTGTAGTATAGT-GGTAAGTATTCCCGCCTGTCACGCGGGTGA-CCCGGGTTCGATCCCCGGCAACGGCG-
>1FFY T   GGGCUUGUAGCUCAGGUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGGUGGUUCAAGUCCACUCAGGCCCAC
0.4
0.551
RF00005 1G59_B
>Target   GTCGTTGTAGTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACG---GCG
>1G59 B   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA
0.4
0.581
RF00005 1G59_D
>Target   GTCGTTGTAGTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACG---GCG
>1G59 D   GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA
0.4
0.581
RF00005 1J1U_B
>Target   GTCGTTGTAGTATAGT--GGTAAGTATTCCCGCCTGTCACGCGGGTGA-CCCGGGTTCGATCCCCGGCAACGGCG
>1J1U B   CCGGCGGUAGUUCAGCCUGGU-AGAACGGCGGACUGUAGAUCCGCAUGUCGCUGGUUCAAAUCCGGCCCGCCGGA
0.392
0.551
RF00005 1U0B_A
>Target   GTCGTTGTAGTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGACCCGGGTTCGATCCCCGGCAACGGC---G
>1U0B A   GGCGCGUUAACAAAGCGGU-UAUGUAGCGGAUUGCAAAUCCGUCUAGUCCGGUUCGACUCCGGAACGCGCCUCCA
0.378
0.565
RF00005 1EHZ_A
>Target   GTCGTTGTAGTATAGT-GGTAAGTATTCCCGCCTGTCACGCGGGTGA-CCCGGGTTCGATCCCCGGCAACGGC---G
>1EHZ A   GCGGAUUUALCUCAGDDGGG-AGAGCRCCAGABU#AAYAP?UGGAG7UC?UGUGTPCG"UCCACAGAAUUCGCACCA
0.368
0.583
RF00005 1EVV_A
>Target   GTCGTTGTAGTATAGT-GGTAAGTATTCCCGCCTGTCACGCGGGTGA-CCCGGGTTCGATCCCCGGCAACGGC---G
>1EVV A   GCGGAUUUALCUCAGDDGGG-AGAGCRCCAGABU#AAYAP?UGGAG7UC?UGUGTPCG"UCCACAGAAUUCGCACCA
0.368
0.583
RF00005 1QTQ_B
>Target   GTCGTTGTAGTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGA-CCCGGGTTCGATCCCCGGCAACGGC---G
>1QTQ B   -GGGGUAUCGCCAAGCGGU-AAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA
0.351
0.538
RF00005 1F7U_B
>Target   GTCGTTGTAGTATAGTGGTAAGTATTCCCGCCTGTCACGCGGGTGA-CCCGGGTTCGATCCCCGGCAACGGC---G
>1F7U B   PUCCUCGUKLCCCAADGGDCACGGCRPCUGGCUICGAACCAGAAGADU?CAGGTPCA"GUCCUGGCGGGGAAGCCA
0.329
0.592

RFAM families found for your sequence with PDB structures with the resolution worse than 2.5 Å:
Valid HTML 4.01! Made with Django.