The results of your job 'Test_Analysis' are ready.
Structure after analysis:
[Test_Analysis.cleaned.without_modifications.changed_sequence.renumbered_chain.pdb]
Modifications:
Modifications present in the structure:
- Residue 16: D (D, 6U, dihydrouridine)
- Residue 17: D (D, 6U, dihydrouridine)
- Residue 20: D (D, 6U, dihydrouridine)
- Residue 37: E (m6t6A, 15A, N6-methyl-N6-threonylcarbamoyladenosine)
- Residue 46: 7 (m7G, 7G, 7-methylguanosine)
- Residue 54: T (m5U, 5U, 5-methyluridine)
- Residue 55: P (Y, 1U, pseudouridine)
Sequence of a given structure:
GCCGAUAUAGCUCAGUUGGUAGAGCAGCGCAUUCGUAAUGCGAAGGUCGU
|
AGGUUCGACUCCUAUUAUCGGCUAUU
|
Secondary structure of a given structure:
(((((((..((((........))))..((((.......))))......((
|
(((.......))))))))))))....
|
Geometry of the structure:
Unusual bond lengths:
- Residue 74 (X[A]:C1',X[A]:N9): 1.37
Unusual dihedral angles:
- Residues 39 --- 38 (X:O3',X+1:P,X+1:O5',X+1:C5'): 21.68
- Residues 8 --- 7 (X:C4',X:C3',X:O3',X+1:P): 97.51
- Residues 37 --- 38 (X:C4',X:C3',X:O3',X+1:P): 314.99
- Residues 39 --- 38 (X:C4',X:C3',X:O3',X+1:P): 19.57
- Residues 48 --- 49 (X:C4',X:C3',X:O3',X+1:P): 110.25
- Residue 20 (X:O5',X:C5',X:C4',X:C3'): 1.62
- Residues 15 --- 16 (X:C3',X:O3',X+1:P,X+1:O5'): 16.95
|