General Data

RNA Type	unknown
Original Source	Sci-ModoM
Transcript ID:	ENST00000466826
Gene ID:	ENSG00000168137
Gene Name:	SETD5
Sequence (UNICHARACTER ENCODING)	AUAUAUGUUACCUUCCAGACCCUGCAGAUGGAGAAGGCCCAGAGACAUUAAGCUCAGCACUCUCUAAAGGAGCAACAGUUUACAGCCCUUCCAGAUACAGCUACCAGCUCCUGCAGUGUGAUAGUCCUCGGACAGAAUCACAAAGCCUCCUUCAGCAGAGUUCCUCCCCCUUCAGAGGACAUCCUACACAGUCUCCAGGAUACAGUUAUCGAЖCUACUGCACUGAGACCUGGAAACCCCCCCUCUCACGGUUCUUCAGAAUCAUCCCUCUCUUCCACGUCCUAU
Sequence (SHORT NAMES ENCODING)	AUAUAUGUUACCUUCCAGACCCUGCAGAUGGAGAAGGCCCAGAGACAUUAAGCUCAGCACUCUCUAAAGGAGCAACAGUUUACAGCCCUUCCAGAUACAGCUACCAGCUCCUGCAGUGUGAUAGUCCUCGGACAGAAUCACAAAGCCUCCUUCAGCAGAGUUCCUCCCCCUUCAGAGGACAUCCUACACAGUCUCCAGGAUACAGUUAUCGAm6ACUACUGCACUGAGACCUGGAAACCCCCCCUCUCACGGUUCUUCAGAAUCAUCCCUCUCUUCCACGUCCUAU
Sequence (MODOMICS CODE ENCODING)	AUAUAUGUUACCUUCCAGACCCUGCAGAUGGAGAAGGCCCAGAGACAUUAAGCUCAGCACUCUCUAAAGGAGCAACAGUUUACAGCCCUUCCAGAUACAGCUACCAGCUCCUGCAGUGUGAUAGUCCUCGGACAGAAUCACAAAGCCUCCUUCAGCAGAGUUCCUCCCCCUUCAGAGGACAUCCUACACAGUCUCCAGGAUACAGUUAUCGA2000000006ACUACUGCACUGAGACCUGGAAACCCCCCCUCUCACGGUUCUUCAGAAUCAUCCCUCUCUUCCACGUCCUAU

Score Table

_{Table containing the score explanation. Score identify the level of experimental reliability and evidence so as exaplained in the 2023 release manuscript. Class 1 should be considered as highlyrelevant. Class 2 evidences are considered as Solid, namely large errors are unlikely and minor errors should not undermine the meaning of data. Class 3 is considered as speculative and errors are expected. Class 4 is considered as questionable. Class 5 evidence means that verification and data are still to be collected. Class 6 data cannot be estimated.}

Method Classification	Score
Multiple direct experimental evidence	1
Direct experimental evidence	2
Inferred based on indirect experimental evidence	3
Predicted computationally	4
Evidence not yet annotated (Unknown)	5
Irrelevant	6

Modification Positions

_{Table containing the original modifications present in the MODOMICS sequences. Edit locations not originally present in the RNA sequences are marked by their source. Their scores are in third row.}

Position in the Sequence	213
Modification Positions	m6A
Genomic Coordinates	3:9475588:+
Level of Experimental Evidence	3
Level of Experimental Reliability	3
Source	Sci-ModoM
EUFIDs	3TeAZFYFxgvp 4HMi5ykupT9V 5aTkEfEpX8Xm 6AyXsheySjfx 6UuHp6YApVKv aivdrAsbdKEU Ap2q43bQLNek gZuvgwMuBfgh jNkxUQNx8GRd msuJfBpJvM5H NjZ8bGGJsNSR Q36pf44ZRvxu QmcpiJ88DBDn QpiKdbVikVz2 UN3tNpbCPHYf VL7zkHvkfkoB VyCX26p5UBRL WdHxkJGRmFxn BsCW7emuRX7M KENzb7mwdBd9 KjeH7Nsffuas Lny8GcCeVGc9 LZJKems7W2wi PF5iqBNSbHaa UKen6WEino9G XUkp6ghERQML