General Data

RNA Type	mRNA
Original Source	Sci-ModoM
Transcript ID:	ENST00000626005
Gene ID:	ENSG00000151093
Gene Name:	OXSM
Sequence (UNICHARACTER ENCODING)	AUGUCCAACUGCCUGCAAAAUUUCCUGAAAAUUACAAGCACUCGUCUUCUAUGUUCAAGAUUAUGCCAACAGUUAAGAAGUAAAAGGAAGUUUUUCGGAЖCUGUGCCAAUAUCCAGAUUGCAUAGGCGAGUUGUCAUUACAGGCAUUGGCUUAGUGЖCUCCUCUUGGUGUUGGAЖCUCACCUGGUUUGGGAUCGUCUUAUCGGAGGAGAGAGUGGAAUUGUUUCACUGGUUGGUGAAGAGUAUAAGAGUAUCCCUUGCAGUGUUGCUGCUUAUGUGCCAAGAGGUAGUGAUGAAGAGCCCGGGCUCUGA
Sequence (SHORT NAMES ENCODING)	AUGUCCAACUGCCUGCAAAAUUUCCUGAAAAUUACAAGCACUCGUCUUCUAUGUUCAAGAUUAUGCCAACAGUUAAGAAGUAAAAGGAAGUUUUUCGGAm6ACUGUGCCAAUAUCCAGAUUGCAUAGGCGAGUUGUCAUUACAGGCAUUGGCUUAGUGm6ACUCCUCUUGGUGUUGGAm6ACUCACCUGGUUUGGGAUCGUCUUAUCGGAGGAGAGAGUGGAAUUGUUUCACUGGUUGGUGAAGAGUAUAAGAGUAUCCCUUGCAGUGUUGCUGCUUAUGUGCCAAGAGGUAGUGAUGAAGAGCCCGGGCUCUGA
Sequence (MODOMICS CODE ENCODING)	AUGUCCAACUGCCUGCAAAAUUUCCUGAAAAUUACAAGCACUCGUCUUCUAUGUUCAAGAUUAUGCCAACAGUUAAGAAGUAAAAGGAAGUUUUUCGGA2000000006ACUGUGCCAAUAUCCAGAUUGCAUAGGCGAGUUGUCAUUACAGGCAUUGGCUUAGUG2000000006ACUCCUCUUGGUGUUGGA2000000006ACUCACCUGGUUUGGGAUCGUCUUAUCGGAGGAGAGAGUGGAAUUGUUUCACUGGUUGGUGAAGAGUAUAAGAGUAUCCCUUGCAGUGUUGCUGCUUAUGUGCCAAGAGGUAGUGAUGAAGAGCCCGGGCUCUGA

Score Table

_{Table containing the score explanation. Score identify the level of experimental reliability and evidence so as exaplained in the 2023 release manuscript. Class 1 should be considered as highlyrelevant. Class 2 evidences are considered as Solid, namely large errors are unlikely and minor errors should not undermine the meaning of data. Class 3 is considered as speculative and errors are expected. Class 4 is considered as questionable. Class 5 evidence means that verification and data are still to be collected. Class 6 data cannot be estimated.}

Method Classification	Score
Multiple direct experimental evidence	1
Direct experimental evidence	2
Inferred based on indirect experimental evidence	3
Predicted computationally	4
Evidence not yet annotated (Unknown)	5
Irrelevant	6

Modification Positions

_{Table containing the original modifications present in the MODOMICS sequences. Edit locations not originally present in the RNA sequences are marked by their source. Their scores are in third row.}

Position in the Sequence	100	157	175
Modification Positions	m6A	m6A	m6A
Genomic Coordinates	3:25791120:+	3:25791177:+	3:25791195:+
Level of Experimental Evidence	3	3	3
Level of Experimental Reliability	3	3	3
Source	Sci-ModoM	Sci-ModoM	Sci-ModoM
EUFIDs	3TeAZFYFxgvp 5FhTyQVy2tKW 5Nnepx5V7yHo 6AyXsheySjfx 6UuHp6YApVKv aHkqKEJkRYyb aivdrAsbdKEU Ap2q43bQLNek gBgcfFQ5WN9C gZuvgwMuBfgh jNkxUQNx8GRd Mg9GixDBFQAT msuJfBpJvM5H nGifePrmgHfe NjZ8bGGJsNSR Q36pf44ZRvxu QmcpiJ88DBDn QpiKdbVikVz2 UN3tNpbCPHYf V5PvfiKsgFMd VL7zkHvkfkoB VyCX26p5UBRL WdHxkJGRmFxn BsCW7emuRX7M KENzb7mwdBd9 KjeH7Nsffuas Lny8GcCeVGc9 LZJKems7W2wi PF5iqBNSbHaa UKen6WEino9G XUkp6ghERQML BtsJQJ3DteUq bXBqJigD9oV3 dknfVe6BK8aP Yfn77uLS5tv8	3TeAZFYFxgvp 4HMi5ykupT9V 5aTkEfEpX8Xm 6AyXsheySjfx 6UuHp6YApVKv aivdrAsbdKEU Ap2q43bQLNek gBgcfFQ5WN9C gZuvgwMuBfgh jNkxUQNx8GRd Mg9GixDBFQAT msuJfBpJvM5H nGifePrmgHfe NjZ8bGGJsNSR Q36pf44ZRvxu QmcpiJ88DBDn QpiKdbVikVz2 UN3tNpbCPHYf V5PvfiKsgFMd VL7zkHvkfkoB VyCX26p5UBRL WdHxkJGRmFxn BkoLW2CBToyL BsCW7emuRX7M Lny8GcCeVGc9 LZJKems7W2wi UKen6WEino9G XUkp6ghERQML BtsJQJ3DteUq bXBqJigD9oV3 dknfVe6BK8aP Yfn77uLS5tv8	3TeAZFYFxgvp 4HMi5ykupT9V 5aTkEfEpX8Xm 5Nnepx5V7yHo 6AyXsheySjfx 6UuHp6YApVKv aivdrAsbdKEU Ap2q43bQLNek gZuvgwMuBfgh jNkxUQNx8GRd msuJfBpJvM5H nGifePrmgHfe NjZ8bGGJsNSR Q36pf44ZRvxu QmcpiJ88DBDn QpiKdbVikVz2 UN3tNpbCPHYf V5PvfiKsgFMd VL7zkHvkfkoB VyCX26p5UBRL WdHxkJGRmFxn BsCW7emuRX7M Lny8GcCeVGc9 LZJKems7W2wi UKen6WEino9G BtsJQJ3DteUq bXBqJigD9oV3 dknfVe6BK8aP S9vNeQQYrhac Yfn77uLS5tv8