General Data

RNA Type	unknown
Original Source	Sci-ModoM
Transcript ID:	ENST00000494666
Gene ID:	ENSG00000163536
Gene Name:	SERPINI1
Sequence (UNICHARACTER ENCODING)	UUUUCCUAUCUCUGAAUGAAAAAAAAAAAUUUCUGAUUCUCUUUUUGCAGAUAAUAAGGAGAUUUUUCUUUCCAAAGCAAUUCACAAGUCCUUCCUAGAGGUUAAUGAAGAAGGCUCAGAAGCUGCUGCUGUCUCAGGAAUGAUUGCAAUUAGUAGGAUGGCUGUGCUGUAUCCUCAAGUUAUUGUCGACCAPCCAUUUUUCUUUCUUAUCAGAAACAGGAGAACUGGUACAAUUCUAUUCAUGGGACGAGUCAUGCAPCCUGAAACAAUGAACACAAGUGGACAUGAUUUCGAAGAACUPUAAGUUACUPUAUUUGAAUAACAAGGAAAACAGUAЖCUAAGCACAUUAUGUUUGCAACUGGUAUAUAUUUAGGAUUUGUGUUUUACAGUAUAUCUUAAGAUAAUAUUUAAAAUAGUUCCAGAUAAAAACAAUAUAUGUAAAUUAUAAGUAЖCUUGUCAAGGAAUGUUAUCAGUAUUAAGCUAAUGGUCCUGUUAUGUCAUUGUGUUUGUGUGCUGUUGUUUAAAAUAAAAGUACCUAUUG
Sequence (SHORT NAMES ENCODING)	UUUUCCUAUCUCUGAAUGAAAAAAAAAAAUUUCUGAUUCUCUUUUUGCAGAUAAUAAGGAGAUUUUUCUUUCCAAAGCAAUUCACAAGUCCUUCCUAGAGGUUAAUGAAGAAGGCUCAGAAGCUGCUGCUGUCUCAGGAAUGAUUGCAAUUAGUAGGAUGGCUGUGCUGUAUCCUCAAGUUAUUGUCGACCAYCCAUUUUUCUUUCUUAUCAGAAACAGGAGAACUGGUACAAUUCUAUUCAUGGGACGAGUCAUGCAYCCUGAAACAAUGAACACAAGUGGACAUGAUUUCGAAGAACUYUAAGUUACUYUAUUUGAAUAACAAGGAAAACAGUAm6ACUAAGCACAUUAUGUUUGCAACUGGUAUAUAUUUAGGAUUUGUGUUUUACAGUAUAUCUUAAGAUAAUAUUUAAAAUAGUUCCAGAUAAAAACAAUAUAUGUAAAUUAUAAGUAm6ACUUGUCAAGGAAUGUUAUCAGUAUUAAGCUAAUGGUCCUGUUAUGUCAUUGUGUUUGUGUGCUGUUGUUUAAAAUAAAAGUACCUAUUG
Sequence (MODOMICS CODE ENCODING)	UUUUCCUAUCUCUGAAUGAAAAAAAAAAAUUUCUGAUUCUCUUUUUGCAGAUAAUAAGGAGAUUUUUCUUUCCAAAGCAAUUCACAAGUCCUUCCUAGAGGUUAAUGAAGAAGGCUCAGAAGCUGCUGCUGUCUCAGGAAUGAUUGCAAUUAGUAGGAUGGCUGUGCUGUAUCCUCAAGUUAUUGUCGACCA2000000009UCCAUUUUUCUUUCUUAUCAGAAACAGGAGAACUGGUACAAUUCUAUUCAUGGGACGAGUCAUGCA2000000009UCCUGAAACAAUGAACACAAGUGGACAUGAUUUCGAAGAACU2000000009UUAAGUUACU2000000009UUAUUUGAAUAACAAGGAAAACAGUA2000000006ACUAAGCACAUUAUGUUUGCAACUGGUAUAUAUUUAGGAUUUGUGUUUUACAGUAUAUCUUAAGAUAAUAUUUAAAAUAGUUCCAGAUAAAAACAAUAUAUGUAAAUUAUAAGUA2000000006ACUUGUCAAGGAAUGUUAUCAGUAUUAAGCUAAUGGUCCUGUUAUGUCAUUGUGUUUGUGUGCUGUUGUUUAAAAUAAAAGUACCUAUUG

Score Table

_{Table containing the score explanation. Score identify the level of experimental reliability and evidence so as exaplained in the 2023 release manuscript. Class 1 should be considered as highlyrelevant. Class 2 evidences are considered as Solid, namely large errors are unlikely and minor errors should not undermine the meaning of data. Class 3 is considered as speculative and errors are expected. Class 4 is considered as questionable. Class 5 evidence means that verification and data are still to be collected. Class 6 data cannot be estimated.}

Method Classification	Score
Multiple direct experimental evidence	1
Direct experimental evidence	2
Inferred based on indirect experimental evidence	3
Predicted computationally	4
Evidence not yet annotated (Unknown)	5
Irrelevant	6

Modification Positions

_{Table containing the original modifications present in the MODOMICS sequences. Edit locations not originally present in the RNA sequences are marked by their source. Their scores are in third row.}

Position in the Sequence	193	259	301	311	337	452
Modification Positions	Y	Y	Y	Y	m6A	m6A
Genomic Coordinates	3:167824528:+	3:167825278:+	3:167825320:+	3:167825330:+	3:167825356:+	3:167825471:+
Level of Experimental Evidence	3	3	3	3	3	3
Level of Experimental Reliability	3	3	3	3	3	3
Source	Sci-ModoM	Sci-ModoM	Sci-ModoM	Sci-ModoM	Sci-ModoM	Sci-ModoM
EUFIDs	BtsJQJ3DteUq dknfVe6BK8aP Mk6ShCGm6RBJ	BtsJQJ3DteUq dknfVe6BK8aP Mk6ShCGm6RBJ	BtsJQJ3DteUq dknfVe6BK8aP Mk6ShCGm6RBJ	BtsJQJ3DteUq CxQaH6qDB9bC dknfVe6BK8aP Mk6ShCGm6RBJ	BtsJQJ3DteUq CxQaH6qDB9bC dknfVe6BK8aP Mk6ShCGm6RBJ	BtsJQJ3DteUq CxQaH6qDB9bC dknfVe6BK8aP Mk6ShCGm6RBJ