General Data

RNA Type	lncRNA
Original Source	Sci-ModoM
Transcript ID:	ENST00000689578
Gene ID:	ENSG00000239911
Gene Name:	PRKAG2-AS1
Sequence (UNICHARACTER ENCODING)	CCACAGUCUCCGGGGGCGCUGCGCGCGAAGUAGCACGUGCUUCUCGAAACACCGCAGCCCCCGGGUCCCGCCCCGCCCGGCGCGCGCACUCGAACCCGCCCAGAGAGCGGUGCGUGGCGCUGGGUGCGAGCAGGGUCUAGCCACCCCCACCCUCACCCCACCCCACCCCACCCUGCUUUUUUCAGGUUCAUCAAGGUUUGCGCAGUGGAUCCGCGGGUGCAUAAAЖCACCCUAUUUGAUGAGAЖCUGGUUUUAAAGGAAAAUGGGGCCAUCAGAAGGAAGCCGGUUGGUGUGAAGAGACGUCUGGGAAGAGCCCCUGGCGAGGGCCCUCAUUCCACUGGGUGЖCCCAGAAGGAGAAAACCGCGAUGGCGCUUCUCAUUUGAAAUGUUUUCUPUAUGGЖCAGUGUUUAGCAAUUGUUAUAAUGUGUACUUUUGUUGAUUGAUCUGUAUACAUAUGUAAAAUAAUUUGUUCUCUGAGUUAAUUUUGUUGGAACAAAGACUPUAGUGCUUCCUACAUUAAAACAUUUUACUGUA
Sequence (SHORT NAMES ENCODING)	CCACAGUCUCCGGGGGCGCUGCGCGCGAAGUAGCACGUGCUUCUCGAAACACCGCAGCCCCCGGGUCCCGCCCCGCCCGGCGCGCGCACUCGAACCCGCCCAGAGAGCGGUGCGUGGCGCUGGGUGCGAGCAGGGUCUAGCCACCCCCACCCUCACCCCACCCCACCCCACCCUGCUUUUUUCAGGUUCAUCAAGGUUUGCGCAGUGGAUCCGCGGGUGCAUAAAm6ACACCCUAUUUGAUGAGAm6ACUGGUUUUAAAGGAAAAUGGGGCCAUCAGAAGGAAGCCGGUUGGUGUGAAGAGACGUCUGGGAAGAGCCCCUGGCGAGGGCCCUCAUUCCACUGGGUGm6ACCCAGAAGGAGAAAACCGCGAUGGCGCUUCUCAUUUGAAAUGUUUUCUYUAUGGm6ACAGUGUUUAGCAAUUGUUAUAAUGUGUACUUUUGUUGAUUGAUCUGUAUACAUAUGUAAAAUAAUUUGUUCUCUGAGUUAAUUUUGUUGGAACAAAGACUYUAGUGCUUCCUACAUUAAAACAUUUUACUGUA
Sequence (MODOMICS CODE ENCODING)	CCACAGUCUCCGGGGGCGCUGCGCGCGAAGUAGCACGUGCUUCUCGAAACACCGCAGCCCCCGGGUCCCGCCCCGCCCGGCGCGCGCACUCGAACCCGCCCAGAGAGCGGUGCGUGGCGCUGGGUGCGAGCAGGGUCUAGCCACCCCCACCCUCACCCCACCCCACCCCACCCUGCUUUUUUCAGGUUCAUCAAGGUUUGCGCAGUGGAUCCGCGGGUGCAUAAA2000000006ACACCCUAUUUGAUGAGA2000000006ACUGGUUUUAAAGGAAAAUGGGGCCAUCAGAAGGAAGCCGGUUGGUGUGAAGAGACGUCUGGGAAGAGCCCCUGGCGAGGGCCCUCAUUCCACUGGGUG2000000006ACCCAGAAGGAGAAAACCGCGAUGGCGCUUCUCAUUUGAAAUGUUUUCU2000000009UUAUGG2000000006ACAGUGUUUAGCAAUUGUUAUAAUGUGUACUUUUGUUGAUUGAUCUGUAUACAUAUGUAAAAUAAUUUGUUCUCUGAGUUAAUUUUGUUGGAACAAAGACU2000000009UUAGUGCUUCCUACAUUAAAACAUUUUACUGUA

Score Table

_{Table containing the score explanation. Score identify the level of experimental reliability and evidence so as exaplained in the 2023 release manuscript. Class 1 should be considered as highlyrelevant. Class 2 evidences are considered as Solid, namely large errors are unlikely and minor errors should not undermine the meaning of data. Class 3 is considered as speculative and errors are expected. Class 4 is considered as questionable. Class 5 evidence means that verification and data are still to be collected. Class 6 data cannot be estimated.}

Method Classification	Score
Multiple direct experimental evidence	1
Direct experimental evidence	2
Inferred based on indirect experimental evidence	3
Predicted computationally	4
Evidence not yet annotated (Unknown)	5
Irrelevant	6

Modification Positions

_{Table containing the original modifications present in the MODOMICS sequences. Edit locations not originally present in the RNA sequences are marked by their source. Their scores are in third row.}

Position in the Sequence	226	244	343	392	398	499
Modification Positions	m6A	m6A	m6A	Y	m6A	Y
Genomic Coordinates	7:151878909:+	7:151878927:+	7:151879026:+	7:151879075:+	7:151879081:+	7:151879182:+
Level of Experimental Evidence	3	3	3	3	3	3
Level of Experimental Reliability	3	3	3	3	3	3
Source	Sci-ModoM	Sci-ModoM	Sci-ModoM	Sci-ModoM	Sci-ModoM	Sci-ModoM
EUFIDs	BtsJQJ3DteUq dknfVe6BK8aP iezFbUdmY3A6 JkWoGWVwjNda a7o5Kmjr4Tdp Yfn77uLS5tv8	6UuHp6YApVKv jNkxUQNx8GRd msuJfBpJvM5H VL7zkHvkfkoB VyCX26p5UBRL BtsJQJ3DteUq dknfVe6BK8aP iezFbUdmY3A6 JkWoGWVwjNda a7o5Kmjr4Tdp Yfn77uLS5tv8	BtsJQJ3DteUq dknfVe6BK8aP iezFbUdmY3A6 JkWoGWVwjNda a7o5Kmjr4Tdp Yfn77uLS5tv8	BtsJQJ3DteUq dknfVe6BK8aP iezFbUdmY3A6 JkWoGWVwjNda a7o5Kmjr4Tdp Yfn77uLS5tv8	6UuHp6YApVKv jNkxUQNx8GRd msuJfBpJvM5H VyCX26p5UBRL Lny8GcCeVGc9 BtsJQJ3DteUq dknfVe6BK8aP iezFbUdmY3A6 JkWoGWVwjNda a7o5Kmjr4Tdp Yfn77uLS5tv8	BtsJQJ3DteUq dknfVe6BK8aP iezFbUdmY3A6 JkWoGWVwjNda a7o5Kmjr4Tdp Yfn77uLS5tv8