General Data

RNA Type	tRNA
SOTerm	None
Original Source	LC530719.1
Secondary Structure	(((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....
Sequence (UNICHARACTER ENCODING)	UAGAUUGAѢLCCAGUUGADUAGGGUGCPUAGCUQUU6ACPAAGUGUUUGUGGGTPUAAGUCCCAUUGGUCUAGCCA
Sequence (SHORT NAMES ENCODING)	UAGAUUGApm1Apm2GCCAGUUGApDUAGGGUGCpYUAGCUpQUUpt6AACpYAAGUGUUUGUGGGpm5UpYUAAGUCCCAUUGGUCUAGCCA
Sequence (MODOMICS CODE ENCODING)	UAGAUUGA2000001551A2000002551GCCAGUUGA2000008551UUAGGGUGC2000009551UUAGCU2000042551GUU2000062551AAC2000009551UAAGUGUUUGUGGG2000005551U2000009551UUAAGUCCCAUUGGUCUAGCCA
Consensus Secondary Structure	.(((((((..((((......[....)))).(((((.......)))))........................(((((..]....))))))))))))....
Alignment with Modification	-AGUAAGGUCAGCUAAAUA------AGCUAPCGGGCC>AUACCCCGAAAAU--------------------GPUGGUUAUAC-CCUUCCCGUACUACCA

Score Table

_{Table containing the score explanation. Score identify the level of experimental reliability and evidence so as exaplained in the 2023 release manuscript. Class 1 should be considered as highlyrelevant. Class 2 evidences are considered as Solid, namely large errors are unlikely and minor errors should not undermine the meaning of data. Class 3 is considered as speculative and errors are expected. Class 4 is considered as questionable. Class 5 evidence means that verification and data are still to be collected. Class 6 data cannot be estimated.}

Method Classification	Score
Multiple direct experimental evidence	1
Direct experimental evidence	2
Inferred based on indirect experimental evidence	3
Predicted computationally	4
Evidence not yet annotated (Unknown)	5
Irrelevant	6

RNA-2D Representation

Modification Positions

_{Table containing the original modifications present in the MODOMICS sequences. Edit locations not originally present in the RNA sequences are marked by their source. Their scores are in third row.}

Position in the alignment	27	34	50
Position in the sequence	24	31	46
Modification positions	Y	f5C	Y
Source	32859890	32859890	32859890

Modification Annotation

_{Table containing the data present in the literature relating to the modification positions present in the RNA sequences. Some of the modified residuals may differ from the modifications originally present in MODOMICS. It follows the same format as the previous table. The table reports the scores that have been associated to the modified nucleotides so to have an estimation of the reliability of their presence.}

Position in the alignment	27	34	50
Position in the sequence	24	31	46
Source: 32859890	Y	f5C	Y
Level of Experimental Reliability	2	2	2
Level of Experimental Evidence	2	2	2