General Data
| RNA Type |
tRNA
|
| SOTerm |
None
|
| Original Source |
LC530721.1
|
| Secondary Structure |
(((((((..((((.....[..)))).(((((.......)))))....(((((..]....)))))))))))).... |
| Sequence (UNICHARACTER ENCODING) |
UAGGAUGGKGUGUGAUAGGDGGCACGGAGAAUPƕUGKAPPCUCAGGGAUGGGTPCGAUUCUCAUAGUCCUAGCCA |
| Sequence (SHORT NAMES ENCODING) |
UAGGAUGGpm1GGUGUGAUAGGpDGGCACGGAGAAUpYptm5s2UUGpm1GApYpYCUCAGGGAUGGGpm5UpYCGAUUCUCAUAGUCCUAGCCA |
| Sequence (MODOMICS CODE ENCODING) |
UAGGAUGG2000001551GGUGUGAUAGG2000008551UGGCACGGAGAAU2000009551U2000254551UUG2000001551GA2000009551U2000009551UCUCAGGGAUGGG2000005551U2000009551UCGAUUCUCAUAGUCCUAGCCA |
| Consensus Secondary Structure |
.(((((((..((((......[....)))).(((((.......)))))........................(((((..]....)))))))))))).... |
| Alignment with Modification |
-UAGGAUGGKGUGUGAUA-GGDG--GCACGGAGAAUPƕUGKAPPCUCAGGG--------------------AUGGGTPCGAUUCUCAUAGUCCUAGCCA |
Score Table
Table containing the score explanation. Score identify the level of experimental reliability and
evidence so as exaplained in the 2023 release manuscript. Class 1 should be considered
as highlyrelevant. Class 2 evidences are considered as Solid, namely large errors are unlikely and minor errors
should not undermine the meaning of data. Class 3 is considered as speculative and errors are expected.
Class 4 is considered as questionable. Class 5 evidence means that
verification and data are still to be collected. Class 6 data cannot be estimated.
| Method Classification |
Score |
| Multiple direct experimental evidence |
1 |
| Direct experimental evidence |
2 |
| Inferred based on indirect experimental evidence |
3 |
| Predicted computationally |
4 |
| Evidence not yet annotated (Unknown) |
5 |
| Irrelevant |
6 |
RNA-2D Representation
RNA Secondary Structure
RNA Consensus Secondary Structure
Comments:
A small amount of carboxymethylaminomethyl-2-thiouridine (cmnm5s2U, 1.3%) was detected in the experiment. Both variants should be retained as 2 as the level of experimental reliability and evidence.
Modification Positions
Table containing the original modifications present in the MODOMICS sequences.
Edit locations not originally present in the RNA sequences are marked by their source.
Their scores are in third row.
| Position in the alignment |
9 |
20 |
33 |
34 |
37 |
39 |
40 |
54 |
55 |
| Position in the sequence |
9 |
20 |
33 |
34 |
37 |
39 |
40 |
53 |
54 |
| Modification positions |
m1G |
D |
Y |
tm5s2U |
m1G |
Y |
Y |
m5U |
Y |
| Source |
32859890 |
32859890 |
32859890 |
32859890 |
32859890 |
32859890 |
32859890 |
32859890 |
32859890 |
Modification Annotation
Table containing the data present in the literature relating to the modification positions present
in the RNA sequences. Some of the modified residuals may differ from the modifications originally
present in MODOMICS. It follows the same format as the previous table. The table reports the scores
that have been associated to the modified nucleotides so to have an estimation of the reliability
of their presence.
| Position in the alignment |
9 |
20 |
33 |
34 |
37 |
39 |
40 |
54 |
55 |
| Position in the sequence |
9 |
20 |
33 |
34 |
37 |
39 |
40 |
53 |
54 |
| Source: 32859890 |
m1G |
D |
Y |
cmnm5s2U |
m1G |
Y |
Y |
m5U |
Y |
| Level of Experimental Reliability |
2 |
2 |
2 |
2 |
2 |
2 |
2 |
2 |
2 |
| Level of Experimental Evidence |
2 |
2 |
2 |
2 |
2 |
2 |
2 |
2 |
2 |